Scispace (Formerly Typeset)
  1. Home
  2. Topics
  3. Upstream activating sequence
  4. 1985
  1. Home
  2. Topics
  3. Upstream activating sequence
  4. 1985
Showing papers on "Upstream activating sequence published in 1985"
Journal Article•10.1016/0092-8674(85)90336-8•
Specific DNA binding of GAL4, a positive regulatory protein of yeast

[...]

Edward Giniger1, Susan M. Varnum1, Mark Ptashne1•
Harvard University1
01 Apr 1985-Cell
TL;DR: It is shown that the yeast positive regulatory protein GAL4 binds to four sites in the upstream activating sequence UASG to activate transcription of the adjacent GAL1 and GAL10 genes, consistent with the idea that GAL2 protein binds to three related 17 bp sequences, each of which displays approximate 2-fold rotational symmetry.

775 citations

Journal Article•10.1016/0092-8674(85)90174-6•
An RNA polymerase II transcription factor binds to an upstream element in the adenovirus major late promoter

[...]

Richard W. Carthew1, Lewis A. Chodosh1, Lewis A. Chodosh2, Phillip A. Sharp1•
Massachusetts Institute of Technology1, Harvard University2
01 Dec 1985-Cell
TL;DR: Results suggest that direct binding of MLTF to an upstream element activates transcription from the major late promoter.

711 citations

Journal Article•10.1016/0168-9525(85)90088-5•
Enhancers and eukaryotic gene transcription

[...]

Edgar Serfling1, Maria Jasin1, Walter Schaffner1•
University of Zurich1
01 Jan 1985-Trends in Genetics
TL;DR: The current view is that enhancers and upstream regulatory elements are composed of a modular arrangement of short sequence motifs each with specific function in conferring inducibility, tissue specificity, or a general enhancement of transcription.

487 citations

Journal Article•10.1073/PNAS.82.24.8419•
Naturally occurring poly(dA-dT) sequences are upstream promoter elements for constitutive transcription in yeast

[...]

Kevin Struhl
01 Dec 1985-Proceedings of the National Academy of Sciences of the United States of America
TL;DR: It appears that longer stretches of poly(dA-dT) are more effective upstream promoter elements for constitutive expression, and these transcriptional effects may be due to exclusion of nucleosomes from poly( dA- dT) regions.
Abstract: pet56, his3, and ded1 are adjacent but unrelated genes located on chromosome XV of the yeast Saccharomyces cerevisiae. his3 and pet56 are transcribed in opposite directions from initiation sites separated by approximately equal to 200 base pairs. Under normal growth conditions, both genes are transcribed at a similar basal level. Deletion analysis of the his3 gene indicates that the upstream promoter element for constitutive expression is defined by a 17-base-pair region that contains 15 thymidine residues in the coding strand. Sequential deletions of the pet56 gene indicate that this same region is required for wild-type transcription levels. Thus, this poly(dA-dT) sequence acts bidirectionally to activate transcription of two unrelated genes. Transcription of the ded1 gene is initiated approximately equal to 300 base pairs downstream from the his3 gene, and it occurs at a 5-fold higher level. This gene contains a 34-base-pair region containing 28 thymidine residues in the coding strand located upstream from the ded1 TATA box. Deletion of this dA-dT stretch significantly reduces transcription below the wild-type level. Thus, for at least three different yeast genes, naturally occurring stretches of poly(dA-dT) serve as upstream promoter elements for constitutive expression. In addition, it appears that longer stretches of poly(dA-dT) are more effective upstream promoter elements. These transcriptional effects may be due to exclusion of nucleosomes from poly(dA-dT) regions.

479 citations

Journal Article•10.1128/JVI.55.2.431-441.1985•
Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

[...]

M F Stinski, T J Roehr
01 Aug 1985-Journal of Virology
TL;DR: The regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene.
Abstract: Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene.

268 citations

Journal Article•10.1073/PNAS.82.24.8557•
The relationship between the "TATA" sequence and transcription initiation sites at the HIS4 gene of Saccharomyces cerevisiae.

[...]

Fumikiyo Nagawa, Gerald R. Fink
01 Dec 1985-Proceedings of the National Academy of Sciences of the United States of America
TL;DR: By inserting synthetic oligonucleotides into a mutant from which TATA-123 had been deleted, it is found that just TATA or TATAA does not work but that TATAAA functions almost as well as the wild-type sequence.
Abstract: Transcription of the HIS4 gene begins at a single site (I) at position -60 from the ATG that begins translation. We have made linker insertions/deletions in the 5' noncoding region to identify the elements required for the specificity of transcription initiation. Although there are four sequences that begin TATA and are near the start of transcription (-170, -132, -123, and -102) only the sequence at -123 (TATA-123) is required for transcription initiation. By inserting synthetic oligonucleotides into a mutant from which TATA-123 had been deleted, we found that just TATA or TATAA does not work but that TATAAA functions almost as well as the wild-type sequence. This hexamer does not work in the opposite orientation (TTTATA). When a synthetic TATA sequence is placed upstream from the normal site, the site of initiation also moves upstream in a roughly cometric way even when TATA-123 is present. Analysis of transcripts in strains where the distance between the TATA sequence and the wild-type site of transcription initiation (I site) has been altered shows that in yeast, unlike higher cells, transcription does not initiate at a strictly defined distance from the TATA sequence. Constructions that alter the distance between the TATA and the I site or remove the I site change the pattern of transcription initiation without affecting the level of HIS4 expression. Deletions that eliminate the I site produce heterogeneous transcripts and deletions that substantially shorten the distance between TATA-123 and the I site initiate at multiple sites downstream from the I site. Thus, both the TATA and the sequences downstream from it determine the pattern of transcription initiation.

244 citations

Journal Article•10.1016/S0092-8674(85)80077-5•
Characterization of drosophila transcription factors that activate the tandem promoters of the alcohol dehydrogenase gene

[...]

Ulrike Heberlein1, England Bruce Padon1, Robert Tjian1•
University of California, Berkeley1
01 Jul 1985-Cell
TL;DR: The results suggest that multiple sequence-specific DNA binding proteins interact differentially with the proximal and distal promoters of Adh to activate transcription.

238 citations

Journal Article•10.1016/S0092-8674(85)80022-2•
Delimitation and properties of DNA sequence: required for the regulated expression of human interferon-β gene

[...]

Takashi Fujita1, Shigeo Ohno, Hidetaro Yasumitsu, Tadatsugu Taniguchi1•
Osaka University1
01 Jun 1985-Cell
TL;DR: Estimation study of mutant IFN-beta genes demonstrates that sequences upstream, but not downstream, of -40 from the cap site are responsible for the viral induction of the gene, and the upstream boundary of the DNA sequences required to support the maximum level of induction lies between -117 and -105 from the caps.

210 citations

Journal Article•10.1073/PNAS.82.1.43•
Specific protein binding to far upstream activating sequences in polymerase II promoters

[...]

Richard J. Bram, Roger D. Kornberg1•
Stanford University1
01 Jan 1985-Proceedings of the National Academy of Sciences of the United States of America
TL;DR: DNase I-protection mapping patterns reveal binding to two 30-base-pair regions at the boundaries of the sequence of GAL1-GAL10 promoter, likely to be the GAL4 gene product.
Abstract: A binding activity specific for the upstream activating sequence of the GAL1-GAL10 promoter of Saccharomyces cerevisiae has been purified 220-fold on the basis of a nitrocellulose filter-binding assay. The binding activity is enriched in a nuclear preparation and is likely to be the GAL4 gene product. DNase I-protection mapping patterns reveal binding to two 30-base-pair regions at the boundaries of the sequence. A nearly identical mapping pattern is obtained with the coordinately regulated GAL7 promoter. The four 30-base-pair regions of binding in the two promoters are closely homologous, with a core consensus sequence of C-G-CG-TG-C-A-A-C-A-G-T-G-C-T-C-C-G-A-A- GC-G-A-T. A synthetic oligonucleotide with such a sequence competes with the upstream activating sequence in the binding reaction.

205 citations

Journal Article•10.1002/J.1460-2075.1985.TB04118.X•
Specific interaction between a transcription factor and the upstream element of the adenovirus-2 major late promoter.

[...]

N.G. Miyamoto, Vincent Moncollin, Jean-Marc Egly, Pierre Chambon
16 Dec 1985-The EMBO Journal
TL;DR: Competition footprinting experiments show that the transcription factor, which binds to the upstream element of the Ad2MLP, can also interact, but with a lower affinity, with the upstream elements of theAd2E2a and rabbit beta‐globin promoters, both of which display some sequence homology to the ‘interacting’ region of the adenovirus‐2 major late promoter upstream element.
Abstract: Stimulation of in vitro transcription mediated by the upstream element of the adenovirus-2 major late promoter (Ad2MLP) involves its recognition by a specific trans-acting factor present in a HeLa whole-cell extract. DNase I footprinting and dimethylsulfate methylation protection experiments were used to determine, at the nucleotide level, upstream sequences which interact with this transcription factor. The ability of upstream element mutants to bind the transcription factor correlates directly with the efficiency of transcription from the corresponding Ad2ML promoters in vivo and in vitro. Competition footprinting experiments show that the transcription factor, which binds to the upstream element of the Ad2MLP, can also interact, but with a lower affinity, with the upstream elements of the Ad2E2a and rabbit beta-globin promoters, both of which display some sequence homology to the 'interacting' region of the Ad2MLP upstream element. The transcription factor does not, however, interact with the upstream elements of either the Ad2E2L, Ad5E3, SV40 early, herpes virus thymidine kinase or chicken conalbumin promoters.

182 citations

Journal Article•10.1038/318371A0•
Upstream sequences modulate the internal promoter of the human 7SL RNA gene

[...]

Elisabetta Ullu1, Alan M. Weiner1•
Yale University1
01 Jan 1985-Nature
TL;DR: It is suggested that the genomic sequences upstream from most Alu elements and 7SL pseudogenes do not contain this element, and consequently that only a small subset of such sequences can be transcribed in vivo.
Abstract: The human genome is rich in sequences which are structurally related to the 7SL RNA component of the signal recognition particle. The 7SL DNA sequence family consists of four 7SL genes, 500 7SL pseudogenes (which are truncated at one or both ends of the 7SL sequence) and 500,000 Alu sequences. Both 7SL genes and Alu elements are transcribed by RNA polymerase III, and we show here that the internal 7SL promoter lies within the Alu-like part of the 7SL gene. Why then does RNA polymerase III transcribe the few 7SL genes so efficiently, while transcripts from the far more abundant Alu elements are not readily detectable? We find that a human 7SL gene and a synthetic Alu sequence derived from it are expressed 50-100-fold more efficiently in vitro than either a representative Alu element or two 7SL pseudogenes. 5' Deletion and insertion mutants of the 7SL gene demonstrate that, in conjunction with the internal promoter, the first 37 nucleotides upstream from the transcription start site are essential for efficient and accurate initiation in vitro. We suggest that the genomic sequences upstream from most Alu elements and 7SL pseudogenes do not contain this element, and consequently that only a small subset of such sequences can be transcribed in vivo. This may help to explain the homogeneity of the Alu family within each mammalian genome, as well as the species-specific differences between mammalian Alu families.
Journal Article•10.1093/NAR/13.20.7269•
Autoregulation plus upstream positive and negative control regions associated with transcriptional activation of the mouse P1450 gene

[...]

Frank J. Gonzalez, Daniel W. Nebert1•
National Institutes of Health1
25 Oct 1985-Nucleic Acids Research
TL;DR: The data are consistent with the presence of several functional regions within the upstream sequence: a promoter region, a region that is negatively autoregulated, possible repressor-binding and inducer-receptor complex-binding sites, and an upstream activation element that is required for transcriptional activation by TCDD.
Abstract: 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is known to interact with a cytosolic receptor and, in turn, activate transcription of the mouse P1(450) gene. Various lengths of DNA upstream of the P1(450) gene were inserted into the pSV0-cat expression vector, with and without addition of the Harvey murine sarcoma virus (Ha-MSV) 72-bp repeat enhancer element. The constructs were cotransfected with pSV2-neo into mouse hepatoma wild-type cells and two variant cell lines. One variant is believed to result from a mutation in the P1(450) structural gene and expresses high levels of P1(450) mRNA constitutively; the other variant has a defect in nuclear translocation of the inducer-receptor complex. After selection in G418, the cells were treated with control medium, TCDD, cycloheximide, or TCDD plus cycloheximide and then assayed for chloramphenicol acetyltransferase (CAT) activity. The data are consistent with the presence of several functional regions within the upstream sequence: a promoter region, a region that is negatively autoregulated, possible repressor-binding and inducer-receptor complex-binding sites, and an upstream activation element that is required for transcriptional activation by TCDD. The Ha-MSV enhancer can substitute for this upstream activation element.
Journal Article•10.1073/PNAS.82.24.8572•
Upstream promoter element of the human metallothionein-IIA gene can act like an enhancer element

[...]

Alois Haslinger, Michael Karin
01 Dec 1985-Proceedings of the National Academy of Sciences of the United States of America
TL;DR: It is shown that the high basal level of transcription of the human metallothionein-IIA gene is due to the presence of an enhancer element within the hMT- IIA promoter region, which suggests a possible functional and evolutionary relationship between enhancers and upstream promoter elements.
Abstract: Initiation of transcription by RNA polymerase II in eukaryotes is strongly increased by cis-acting genetic elements, known as activators or enhancers. Enhancers, first detected in simian virus 40 (SV40), were subsequently also found to control the expression of several cellular genes. The human metallothionein-IIA (hMT-IIA) gene, although inducible by heavy metals and glucocorticoids, is widely expressed in most cell types in the absence of inducers. Here we show that the high basal level of transcription of the hMT-IIA gene is due to the presence of an enhancer element within the hMT-IIA promoter region. The structural and functional organization of this cellular enhancer element in two direct repeats is strikingly similar to that of the enhancer element of SV40. This suggests a possible functional and evolutionary relationship between enhancers and upstream promoter elements.
Journal Article•10.1002/J.1460-2075.1985.TB03775.X•
The adenovirus-2 early EIIa transcription unit possesses two overlapping promoters with different sequence requirements for EIa-dependent stimulation.

[...]

D A Zajchowski, Hélène Boeuf, Claude Kedinger
01 May 1985-The EMBO Journal
TL;DR: Analysis of promoter deletion and linker scanning mutations for in vivo transcriptional activity after transfection into HeLa cells has indicated the existence of two overlapping promoters in the EIIaE gene.
Abstract: The EIa-inducible, EIIa transcription unit of adenovirus-2 is transcribed early in infection from two start sites (+1 or EIIaE1 and -26 or EIIaE2), neither of which is preceded by canonical TATA box elements. Analysis of promoter deletion and linker scanning mutations for in vivo transcriptional activity after transfection into HeLa cells has indicated the existence of two overlapping promoters in the EIIaE gene. Two regions, each approximately 30 nucleotides upstream from start sites EIIaE1 and EIIaE2, function as TATA box substitutes. A sequence centered at position -42 (with respect to the major start site at position +1) is essential for transcription from both sites, while an element further upstream, localized between nucleotides -91 and -62, is also required for efficient EIIaE transcription, with the 3' border being dispensable for EIIaE2 transcription. Analysis of the entire series of EIIaE mutants, co-transfected with an EIa-containing plasmid, revealed that no unique sequence elements in the EIIaE1 promoter region between -97 and +1 were responsible for the stimulation of EIIaE1 transcription by EIa. In contrast, the EIa-mediated augmentation of EIIaE2 template activity was mainly dependent upon a sequence, the 5'-TTAAATTT-3' putative TATA box substitute, located around position -59.
Journal Article•10.1073/PNAS.82.2.381•
An enhancer-like element in the adenovirus E2 promoter contains sequences essential for uninduced and E1A-induced transcription.

[...]

Michael J. Imperiale, Ronald P. Hart, Joseph R. Nevins
01 Jan 1985-Proceedings of the National Academy of Sciences of the United States of America
TL;DR: It is suggested that E1A-mediated induction involves the effective increase in a factor utilizing this upstream site and that the factor can functionally interact with the site irrespective of its location relative to the start of transcription.
Abstract: Using a chloramphenicol acetyltransferase gene under the control of a series of adenovirus E2 promoter mutants, we have determined the sequence requirements for E1A-induced as well as uninduced expression of the E2 promoter. Fully induced expression requires 79 nucleotides of upstream sequence, and the same sequences are required for uninduced expression. A promoter containing 70 nucleotides of upstream sequence is inducible, although to a lower level than wild type, while a promoter containing 59 nucleotides of upstream sequence is not inducible. The sequences required for induction as well as for uninduced promoter activity map between 21 and 79 nucleotides upstream of the transcriptional initiation site and function in either orientation and at a distance. We suggest that E1A-mediated induction involves the effective increase in a factor utilizing this upstream site and that the factor can functionally interact with the site irrespective of its location relative to the start of transcription.
Journal Article•10.1128/MCB.5.2.380-389.1985•
Identification of promoter elements necessary for transcriptional regulation of a human histone H4 gene in vitro.

[...]

S M Hanly, G C Bleecker, N Heintz
01 Feb 1985-Molecular and Cellular Biology
TL;DR: The results indicate that the cell cycle regulation of human histone gene expression involves both a specific transcription factor and distal transcription signals in the H4 promoter.
Abstract: We have examined the nucleotide sequences necessary for transcription of a human histone H4 gene in vitro. Maximal transcription of the H4 promoter requires, in addition to the TATA box and cap site, promoter elements between 70 and 110 nucleotides upstream from the transcription initiation site. These distal promoter elements are recognized preferentially in extracts from synchronized S-phase HeLa cells. The inability of non-S-phase nuclear extracts to recognize the H4 upstream sequences reflects a specific lack of a transcription factor which interacts with those sequences. These results indicate that the cell cycle regulation of human histone gene expression involves both a specific transcription factor and distal transcription signals in the H4 promoter.
Journal Article•10.1073/PNAS.82.9.2660•
Initiation of transcription from each of the two human mitochondrial promoters requires unique nucleotides at the transcriptional start sites

[...]

James E. Hixson1, David A. Clayton1•
Stanford University1
01 May 1985-Proceedings of the National Academy of Sciences of the United States of America
TL;DR: The data clearly confirm the previous assignment of promoter functions for these elements and show that single nucleotide substitutions immediately upstream of the transcriptional start sites can abolish transcription.
Abstract: Promoters for transcriptional initiation on each strand of human mtDNA lie in close proximity in the displacement-loop region. Transcription initiates within these promoter elements, providing an opportunity to analyze the effects of nucleotide sequence changes on the efficiency and fidelity of this event within two delimited regions. Each promoter was individually altered by a site-directed mutagenesis approach and assayed in vitro for the ability to support transcription. The data clearly confirm the previous assignment of promoter functions for these elements and show that single nucleotide substitutions immediately upstream of the transcriptional start sites can abolish transcription. In all cases of decreased transcription, the correct site of initiation is maintained. Although the heavy-strand promoter and light-strand promoter are similar in primary sequence, they exhibit remarkably different sensitivities to base substitutions.
Journal Article•10.1128/MCB.5.7.1743-1749.1985•
Deletion analysis identifies a region, upstream of the ADH2 gene of Saccharomyces cerevisiae, which is required for ADR1-mediated derepression.

[...]

D R Beier, A Sledziewski, Elton T. Young
01 Jul 1985-Molecular and Cellular Biology
TL;DR: The hypotheses that the ADH2 promoter may normally be in an inactive conformation in the yeast chromosome and that derepression ofADH2 requires positive activation mediated through an upstream activation sequence located between 216 and 257 base pairs 5' to the start site of ADH 2 transcription are supported.
Abstract: Deletion analysis was used to identify sequences upstream of the ADH2 gene of Saccharomyces cerevisiae that are required for its regulation. 5' and 3' internal deletions of the ADH2 control region were created in vitro, and the fragments were ligated adjacent to the ADH1 promoter and structural gene. Hybrid genes with 3' deletions extending from -119 to -216 (the start site of ADH2 transcription is designated +1) were fully repressed and derepressed to high levels. Hybrid genes with 3' deletions extending from -119 to -257 were repressed but failed to significantly derepress. Hybrid genes lacking the -216 to -257 region also failed to respond to ADR1-5c, a mutant allele of the unlinked regulatory gene ADR1, which confers constitutive expression on ADH2. This implies that the region between these deletion endpoints, which includes a 22-base-pair sequence of dyad symmetry, is required for efficient derepression of an adjacent promoter. Internal deletions extending in the 3' direction from position -1141 confirmed these results. Deletion mutants lacking the region -1141 to -259 were normally regulated, whereas deletions extending from -1141 to -115 were not derepressible. These results support the hypotheses that the ADH2 promoter may normally be in an inactive conformation in the yeast chromosome and that derepression of ADH2 requires positive activation mediated through an upstream activation sequence located between 216 and 257 base pairs 5' to the start site of ADH2 transcription. No evidence for a DNA sequence mediating repression was obtained.
Journal Article•10.1016/0378-1119(85)90188-X•
Analysis of the inducible MEL1 gene of Saccharomyces carlsbergensis and its secreted product, alpha-galactosidase (melibiase).

[...]

Martin Sumner-Smith, Richard Paul Bozzato, Nigel Skipper, R. Wayne Davies, James E. Hopper1 •
Penn State Milton S. Hershey Medical Center1
01 Jan 1985-Gene
TL;DR: The nucleotide sequence of the MEL1 gene of Saccharomyces carlsbergensis and the N-terminal amino acid sequence of its extracellular gene product, alpha-galactosidase (melibiase) (alpha-Gal) are determined.
Journal Article•10.1007/BF00397995•
Transcription of the gene encoding the 51 kd chlorophyll a -apoprotein of the photosystem II reaction centre from spinach

[...]

Peter Westhoff
01 Sep 1985-Molecular Genetics and Genomics
TL;DR: Transcription of the plastid gene encoding the 51 kd chlorophyll a-conjugated polypeptide, which is presumed to carry the P680 reaction centre chlorophyh of photosystem II, has been studied both in vivo and in vitro in spinach.
Abstract: Transcription of the plastid gene encoding the 51 kd chlorophyll a-conjugated polypeptide, which is presumed to carry the P680 reaction centre chlorophyll of photosystem II, has been studied both in vivo and in vitro in spinach. The gene is part of a polycistronic transcription unit whose expression involves both transcriptional and post-transcriptional regulation. Two distinct transcripts have been detected in RNA from chloroplasts as well as from etioplasts which start 55 and 175 nucleotides upstream of the protein-coding region. In vitro transcription of the gene in a homologous chloroplast extract yields only the “-175” terminus and only this 5′ end is preceded by typical prokaryotic promoter elements. The “-55” terminus lacks similar sequences but starts within a stem-loop structure. This suggests that the transcription initiation site of the gene is located 175 nucleotides upstream of the translational start codon and that the latter terminus is the result of post-transcriptional processing of the primary transcript. The start site for another transcription unit which is read in the opposite direction has been mapped 210 bp proximal to the “-175” terminus. The nature of its product is unknown. It is likely that the intergenic region contains all sequence elements necessary for the accurate transcription of both genes.
Journal Article•10.1016/0022-2836(85)90400-0•
A region flanking the GAL7 gene and a binding site for GAL4 protein as upstream activating sequences in yeast.

[...]

Yahli Lorch1, Roger D. Kornberg1•
Stanford University1
20 Dec 1985-Journal of Molecular Biology
TL;DR: A region of DNA 116 to 271 base-pairs upstream from the GAL7 gene of Saccharomyces cerevisiae activates transcription from a heterologous promoter and does so in either orientation, showing that the G AL7 upstream region contains an upstream activating sequence (UAS).
Journal Article•10.1128/MCB.5.6.1473•
Structure of the Dictyostelium discoideum prestalk D11 gene and protein.

[...]

Eric Barklis1, B Pontius1, Harvey F. Lodish1•
Massachusetts Institute of Technology1
01 Jun 1985-Molecular and Cellular Biology
TL;DR: The deduced D11 protein is exceptionally rich in cysteine residues and consists of a 25-amino acid hydrophobic leader sequence followed by a series of repeats with the structure LA1B1A2B2C1B3C2B4C3B5C4B6.
Abstract: The gene encoding the prestalk D11 mRNA of Dictyostelium discoideum has been isolated and characterized. Transcriptional mapping and sequence data indicated that the D11 message is unspliced and contains an 846-base open reading frame. The 273 base pairs upstream from the translation initiator codon are 88% A + T, typical of Dictyostelium upstream sequences, and contain no recognizable upstream activator sequence. The deduced D11 protein is exceptionally rich in cysteine residues and consists of a 25-amino acid hydrophobic leader sequence (L) followed by a series of repeats with the structure LA1B1A2B2C1B3C2B4C3B5C4B6, where A, B, and C, are, respectively, amino acid sequences of 39, 18, and 15 residues. The deduced D11 protein shares certain similarities with the Dictyostelium cyclic AMP phosphodiesterase inhibitor protein.
Journal Article•10.1128/JB.161.2.544-551.1985•
Regulation of transcription of the repA1 gene in the replication control region of IncFII plasmid NR1 by gene dosage of the repA2 transcription repressor protein.

[...]

Xinnian Dong, David D. Womble, Verne A. Luckow, Robert H. Rownd
01 Feb 1985-Journal of Bacteriology
TL;DR: Using both lac gene fusions and quantitative hybridization methods, the in vivo relationship between the rate of transcription from the regulated promoter and the repressor protein concentration as a function of gene dosage is determined.
Abstract: Transcription of the repA1 gene of the IncFII plasmid NR1 is initiated at two promoters in the replication control region. Transcription from the upstream promoter is constitutive at a low level, whereas transcription from the downstream promoter is regulated. The 5' end of the constitutively synthesized transcript also encodes the transcription repressor protein for the regulated downstream promoter. Therefore, the level of the repressor protein in the cell is gene dosage dependent. Using both lac gene fusions and quantitative hybridization methods, we have determined the in vivo relationship between the rate of transcription from the regulated promoter and the repressor protein concentration as a function of gene dosage. At the wild-type copy number of NR1, transcription from the regulated promoter is 96% repressed, but substantial derepression occurs when the copy number falls below the normal value. At or above the normal plasmid copy number, the basal level of repA1 mRNA is provided by transcription from the constitutive upstream promoter.
Journal Article•10.1002/J.1460-2075.1985.TB04031.X•
Identification of a sequence element in the promoter of the Drosophila melanogaster hsp23 gene that is required for its heat activation.

[...]

R Mestril, Duri Rungger, Paul C. Schiller, Richard Voellmy
01 Nov 1985-The EMBO Journal
TL;DR: The expression of Drosophila melanogaster hsp23‐Escherichia coli beta‐galactosidase hybrid genes containing different segments of the 5′ non‐transcribed sequence of the hSp23 gene has been examined at the RNA and protein levels in Xenopus oocytes and the importance of this regulatory sequence for a second hsp gene is demonstrated.
Abstract: The expression of Drosophila melanogaster hsp23-Escherichia coli beta-galactosidase hybrid genes containing different segments of the 5' non-transcribed sequence of the hsp23 gene has been examined at the RNA and protein levels in Xenopus oocytes. Transcription of the hybrid genes is initiated correctly. Mutant genes with hsp23 gene promoter segments of at least 140 bp in length are strongly heat-activated while genes with shorter promoter segments are expressed constitutively and at low levels. This maps an element required for the heat-controlled expression of the D. melanogaster hsp23 gene to a region, approximately 140 bp upstream from the start of the transcription site, which contains a sequence (CGAGAAGTT-TCGTGT) that is closely related to the one responsible for the heat regulation of the hsp70 gene. These findings demonstrate the importance of this regulatory sequence for a second hsp gene and support the notion that hsp genes are heat-regulated by a common mechanism. The functional element in the hsp23 gene promoter is located greater than 80 bp further upstream from the TATA box than the relevant element in the hsp70 gene promoter. Even though other related sequences are present further upstream and downstream from the functional element, they play at most an auxiliary role in the regulation of hsp23 gene expression.
Journal Article•10.1093/NAR/13.11.4067•
Cis and trans activation of adenovirus IVa2 gene transcription.

[...]

Venkatachala Natarajan, Norman P. Salzman
11 Jun 1985-Nucleic Acids Research
TL;DR: It was seen that sequences -38 to -64 base pairs upstream of the RNA initiation site are necessary for efficient transcription and the E1A gene in trans and an enhancer in cis have an additive effect on RNA synthesis from both IVa2 and major late promoters.
Abstract: The transcriptional control region of the adenovirus IVa2 promoter was analyzed by cloning this promoter in front of a gene coding for bacterial chloramphenicol acetyl transferase (CATase) and estimating levels of CATase and IVa2 promoter specific RNA synthesized after transfection. To produce detectable amounts of CATase with the IVa2 promoter, an enhancer has to be present in cis. In the absence of enhancer sequences, the adenovirus E1A gene can not stimulate CATase synthesis. When cells were transfected with plasmids containing enhancer sequences and various IVa2 mutant promoters upstream of the CAT gene, we observed that CATase activity was not reduced significantly even after deletion of all sequences upstream of the RNA initiation site. Synthesis of IVa2 specific RNA was dependent on plasmids containing an enhancer (SV40 72 bp repeat) that was present in cis. In the absence of enhancer sequences, co-transfection to provide the adenovirus E1A gene in trans also stimulated IVa2 RNA synthesis. When HeLa cells were transfected with various deletion mutants with an enhancer in cis it was seen that sequences -38 to -64 base pairs upstream of the RNA initiation site are necessary for efficient transcription. The E1A gene in trans and an enhancer in cis have an additive effect on RNA synthesis from both IVa2 and major late promoters. The basis for the conflicting results between transcription and CATase synthesis is discussed.
Journal Article•10.1128/MCB.5.8.1901•
Suppressors of Saccharomyces cerevisiae his3 promoter mutations lacking the upstream element.

[...]

Marjorie A. Oettinger, Kevin Struhl
01 Aug 1985-Molecular and Cellular Biology
TL;DR: Although ope mutations restore wild-type levels of transcription, his3 chromatin structure, as assayed by micrococcal nuclease sensitivity of the TATA box, resembles that found in the his3-delta 13 parent rather than in the wild- type strain, providing further evidence that Tata box sensitivity is not correlated with transcriptional activation.
Abstract: Transcription of the Saccharomyces cerevisiae his3 gene requires an upstream promoter element and a TATA element. A strain containing his3-delta 13, an allele which deletes the upstream promoter element but contains the TATA box and intact structural gene, fails to express the gene and consequently is unable to grow in medium lacking histidine. In this paper we characterize His+ revertants of his3-delta 13 which are due to unlinked suppressor mutations. Recessive suppressors in three different ope genes allow his3-delta 13 to be expressed at wild-type levels. In all cases, the suppression is due to increased his3 transcription. However, unlike the wild-type his3 gene, whose transcripts are initiated about equally from two different sites (+1 and +12), transcription due to the ope mutations is initiated only from the +12 site, ope-mediated transcription is regulated in a novel manner; it is observed in minimal medium, but not in rich broth. Although ope mutations restore wild-type levels of transcription, his3 chromatin structure, as assayed by micrococcal nuclease sensitivity of the TATA box, resembles that found in the his3-delta 13 parent rather than in the wild-type strain. This provides further evidence that TATA box sensitivity is not correlated with transcriptional activation. ope mutations are pleiotropic in that cells have a crunchy colony morphology and lyse at 37 degrees C in conditions of normal osmolarity. ope mutations are allele specific because they fail to suppress five other his3 promoter mutations. We discuss implications concerning upstream promoter elements and propose some models for ope suppression.
Patent•
Hybrid nucleic acid sequences having tandemly arranged genes

[...]

Nancy Lee, Norman R. Wainwright
5 Feb 1985
TL;DR: In this paper, a hybrid nucleic acid sequence for use in producing one or more selected polypeptides in a host cell is provided which comprises: a promoter sequence recognized by the host cell at one end; a transcription terminator sequence recognized at the other end.
Abstract: @ A hybrid nucleic acid sequence for use in producing one or more selected polypeptides in a host cell is provided which comprises: a promoter sequence recognized by the host cell at one end; a transcription terminator sequence recognized by the host cell at the other end; and between the promoter sequence and the transcription terminator sequence: a first region which includes a ribosome-binding site, a translation initiation site, a coding region for one of said one or more selected polypeptides, and a translation termination site. but which does not include the promoter sequence or the transcription terminator sequence; and one or more second regions, each of which includes a ribosome-binding site, a translation initiation site, a coding region for the same or a different one of said one or more selected polypeptides, and a translation termination site, and which does not include the promoter sequence or the transcription terminator sequence, the reading directions of the promoter sequence, the transcription terminator sequence, the first region and each of the second regions having the same orientation.
Journal Article•10.1016/0378-1119(85)90095-2•
Deletion analysis of a bacteriophage T4 late promoter.

[...]

Toni A. Völker1, Beat Keller1, Thomas A. Bickle1•
University of Basel1
01 Jan 1985-Gene
TL;DR: The results of the BAL 31 unidirectional deletion analysis confirm those of Elliott and Geiduschek that no sequences upstream from the consensus sequence are necessary for late transcription activity and provide evidence that sequences downstream from theensus sequence are important.
Journal Article•10.1042/BST0130754•
The role of an upstream sequence in the transcription of a human transfer RNA gene

[...]

John P. Goddard1, Aileen McLAREN1, Tom Carr1, Mariann Bienz2, J.D. Smith2 •
University of Glasgow1, Laboratory of Molecular Biology2
01 Aug 1985-Biochemical Society Transactions
Journal Article•10.1128/MCB.5.7.1560-1570.1985•
Orientation-dependent transcriptional activator upstream of a human U2 snRNA gene

[...]

Manuel Ares, Marguerite Mangin, Alan M. Weiner
01 Jul 1985-Molecular and Cellular Biology
TL;DR: The structure of the promoter for the human U2 snRNA gene, a strong RNA polymerase II transcription unit without an obvious TATA box, is examined and it is suggested that upstream activator elements may be a general feature of snRNA promoters.
Abstract: We examined the structure of the promoter for the human U2 snRNA gene, a strong RNA polymerase II transcription unit without an obvious TATA box. A set of 5' deletions was constructed and assayed for the ability to direct initiation of U2 snRNA after microinjection into Xenopus oocytes. Sequences between positions -295 and -218 contain an activator element which stimulates accurate initiation by 20- to 50-fold, although as few as 62 base pairs of 5' flanking sequence are sufficient to direct the accurate initiation of U2 RNA. When the activator was recloned in the proper orientation at either of two different upstream locations, the use of the normal U2 start site was stimulated. Inversion of the element destroyed the stimulation of accurate U2 initiation, but initiation at aberrant upstream start sites was enhanced by the element in both orientations. A 4-base-pair deletion that destroyed the activity of the element lies within a sequence (region III) which is highly conserved among U2 genes from different organisms. Mutations in the activator also affected the ability of the U2 template to compete with a wild-type U1 gene in coinjection experiments. We propose that the element enhances the efficiency of transcription in part by facilitating the association of a limiting factor with transcription complexes. Human U1 snRNA genes possess a region homologous to U2 region III, and we suggest that upstream activator elements may be a general feature of snRNA promoters.

Tools

SciSpace AgentBiomedical AgentSciSpace RecruitSciSpace for EnterpriseAgent GalleryChat with PDFLiterature ReviewAI WriterFind TopicsParaphraserCitation GeneratorExtract DataAI DetectorCitation Booster

Learn

ResourcesLive Workshops

SciSpace

CareersSupportBrowse PapersPricingSciSpace Affiliate ProgramCancellation & Refund PolicyTermsPrivacyData Sources

Directories

PapersTopicsJournalsAuthorsConferencesInstitutionsCitation StylesWriting templates

Extension & Apps

SciSpace Chrome ExtensionSciSpace Mobile App

Contact

support@scispace.com
SciSpace

© 2026 | PubGenius Inc. | Suite # 217 691 S Milpitas Blvd Milpitas CA 95035, USA

soc2
Secured by Delve