Abstract: Myrmotherula garbei zimmeri Chapman, 1925 Includes the subpopulation designated zimmeri in the analysis. Diagnosis. Myrmotherula garbei zimmeri is distinguished from the nominate form of M. garbei by diagnosable differences in female plumage characters provided in the description of M. garbei and considered a subspecies of M. garbei based on the consistency of their vocalizations. Distribution. South of the Rio Napo, north of the Rio Marañón, and east of the Andes in Ecuador and Peru. Remarks. Refer to remarks under M. garbei. If confirmed, the conclusion that this subpopulation should be considered a subspecies of M. garbei is supported by the phylogeny. Myrmotherula garbei zimmeri (39 recordings). ECUADOR: Canelos 1; Kapawi Lodge 4; 15–80 km W Loreto 3; La Selva Lodge on S bank Río Napo 1; Miazal 5; Maxus Road km 37 1; Río Suno 1; Tiputini Biodiversity Station 9. PERU: Explorama Inn 1; Explorama Lodge 6; Huampami 1; Quebrada Orán 2; Roca Eterna 2; upper Río Tigre 1; Yanamono 1. Myrmotherula garbei zimmeri. ECUADOR: 1.5 km S Libertad 2♀, 2♂; Río Suno 1♂; Río Suno Abajo 1♀, 1♂; Taisha 5♂.

Abstract: Myrmotherula cinereiventris Sclater and Salvin, 1868, subspecies elevated to species Northern Gray Antwren Includes the study populations designated cinereiventris, pallida- E, and pallida- W in the analysis. Diagnosis. Myrmotherula cinereiventris is distinguished from M. menetriesii s.s. and M. omissa by vocalizations and plumage. The structure of notes in M. cinereiventris Songs differs from that of M. menetriesii Songs (Fig. 6), and the note pattern in M. cinereiventris Long Calls differs from those in M. menetriesii and M. omissa in the sequence of types of notes (Fig. 7). The male differs from male M. menetriesii in having a gray rather than black throat and upper breast. Description of female plumage. Females of the nominate population have upperparts between Olive Gray and Olive (5Y4/2–5Y4/3), wings and tail with pale feather edgings colored like underparts; and underparts Yellow Ochre (10YR7/6), paler on chin and sides of head. Distribution. Bounded on the north in Colombia by the Rio Inírida, extending north to Meta along Andean foothills, and in Venezuela by the Rio Orinoco; on the northeast by the Atlantic Ocean in the Guianas; on the east by the Atlantic Ocean in Brazil; on the south by the Rio Amazonas and Rio Marañón; and on the west by Andean foothills. Remarks. Coloration of male of M. c. pallida is similar to nominate but paler, and female is distinctly grayer above and darker below compared to nominate. Specific status for Myrmotherula cinereiventris is supported by distinctions in vocalizations (Song and Long Call differ from those of both M. menetriesii s.s. and M. omissa) and in plumage (female coloration and the absence of the male breast patch of M. menetriesii s.s). Species status is reinforced by mtDNA genetic distances of ~5.0% among the three species that formerly constituted M. menetriesii sensu lato. Myrmotherula c. cinereiventris (42 recordings). BRAZIL: AMAPÁ: Serra do Navio 5; AMAZONAS: Presidente Figueiredo 1; 60–90 km N of Manaus 3. FRENCH GUIANA: Laussat Mana 1. GUYANA: Baramita 1; Maipama Creek 1; Rewa River 1. SURINAME: Brownsberg Nature Reserve 6; Foengoe Eiland 1; Kabalebo Nature Reserve 3; Mozeskreek 1; Raleigh Vallen 1; Voltzberg 2. VENEZUELA: Campamento Rio Grande 1; El Palmar 5; La Escalera 8; Santa Elena de Uairén 1. Myrmotherula c. cinereiventris. BRAZIL: AMAPÁ: Porto Platon 2♀, 2♂; Serra do Navio 1♀, 2♂; PARÁ: Faro 4♀, 1♂; Obidos 2♀; RORAIMA: Sorocaima 1♂. FRENCH GUIANA: Saut Tamanoir 4♀, 4♂. GUYANA: Acarai Mountains, 1♂; Baramita 1♀; Georgetown, 1♂; mouth of Onoro River 1♀; Sipu River 1♀. VENEZUELA: Río Yuruán 1♀, 3♂.

Abstract: Ochlodes (Ochluma) sylvanoides dempwolfi Grishin, new subspecies http://zoobank.org/ F27AE8D7-F5DA-4B7F-B444-A3343470021A (Figs. 19 part, 20 part, 21e–f) Definition and diagnosis. Genomic analysis reveals that populations from the northeastern part of the range, historically identified as Ochlodes napa (W. H. Edwards, 1865) (type locality in USA: Colorado, Clear Creek Co.), are not in the same clade with this species but instead belong to Ochlodes (Ochluma) sylvanoides (Boisduval, 1852) (type locality in USA: California, Plumas Co.), being genetically differentiated from others at the subspecies level (Fig. 20a violet and magenta). While their COI barcodes (or mitogenomes, Fig. 20b) do not consistently differ, these populations together form a distinct moderately supported (88% bootstrap value) clade in the nuclear genome tree (Fig. 20a) that partitions into two more strongly supported subclades: northeastern (Fig. 20a violet, 93% bootstrap) and southwestern (Fig. 20a magenta, 100% bootstrap). The southwestern clade represents a new subspecies described above. Its sister, the northeastern clade, includes specimens from a wider geographical area from southern Alberta and Saskatchewan in Canada, to North Dakota in the U.S. (Fig. 19 violet). These specimens are characterized by phenotypic and genetic differences from other subspecies of O. sylvanoides and, therefore, represent a new subspecies. This new subspecies keys to “ Ochlodes sylvanoides napa ” (M.19.2(c)) in Evans (1955), but differs from it and other relatives by being intermediate in appearance between the nominate and the new subspecies described above or O. napa: both sides of wings are paler than a typical nominate specimen (Fig. 21a), but the marginal brown areas above are also rather wide and more prominently scalloped, with sharply defined edges on the forewing and more diffuse on the hindwing; the ventral hindwing with muted reddish-brown ground color, which is less bright than in the nominate subspecies, but darker than in O. sylvanoides paranapa ssp. n. (Fig. 21b– d) and both darker and redder than in O. napa (Fig. 21g –j); and the dorsal pattern of orange bands of spots is unique in terms of each spot being slightly yellower in the middle and more orange around, instead of uniformly toned, as in other subspecies. Due to extensive individual variation in wing patterns, this subspecies is best identified by DNA, with diagnostic base pairs in the nuclear genome: aly848.2.60: G48A, aly25.8.2:C84T, aly25.8.2:C87T, aly935.4.26:G54A, aly935.4.26:C67T; and the COI barcode does not distinguish this subspecies from others. Barcode sequence of the holotype. Sample NVG-23032D05, GenBank PV892291, 658 base pairs: AACTTTATACTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGCGATGACCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAA TAAATAATATAAGATTTTGAATATTACCTCCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTATATCCTCCTTTATCTTCTAATATTGC TCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCTATTCTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGAATTAAAAACTTATCA TTTGATCAAATACCCTTATTTGTATGATCAGTAGGTATTACAGCATTATTATTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACAATATTACTTACTGATCGAAATTTAAATACTT CTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 21e, bears the following five printed rectangular labels, four white: [ND: Slope Co. elev 2560' | East River Road, approximately | 1.75 miles from Burning Coal | Vein Campground 46° 35' 51.1" | N, 103° 27' 24.5" W August 23, | 2023 Leg: W. R. Dempwolf], [Ochlodes sylvanoides | napa | ♂ | Coll of: W R Dempwolf], [DNA sample ID: | NVG-23032D05 | c/o Nick V. Grishin], [WRD 23,554], and one red [HOLOTYPE ♂ | Ochlodes sylvanoides | dempwolfi Grishin]. Paratypes: 1♂ and 3♀♀: from USA, North Dakota, Slope Co. data as the holotype except as indicated, [WRD]: 1♂ NVG-23032D06, WRD 23555 22-Aug-2023, 1♀ NVG-23032D02, WRD 23551; 1♀ NVG-23032D03; WRD 23552 (Fig. 21f); and 1♀ NVG-23032D04, WRD 23553 East River Road, ca. 18 mi south of Medora, 2647’, 46.698 861, −103.487 417, 22-Aug-2023. Other specimens: Due to genetic similarity (Fig. 20), we currently attribute the following three sequenced specimens from Canada in the CNC to this subspecies but exclude them from the type series because they exhibit some differences compared to the population at the type locality: Alberta: 1♂ NVG-24014A07, CNCLEP 00169968 Taber, 49.787 3, −112.149 0, 16-Aug-1996, T. Pike leg. and 1♀ NVG-24014A06, CNCLEP 00169953 Hwy 880 & US border, 49.000 0, −111.266 7, 16-Aug-1998, R. A. Layberry leg. and 1♂ NVG-24014A05, CNCLEP 00169950 Saskatchewan, Val Marie, 49.246 4, −107.728 3, 10-Aug-1983, R. Hooper leg. Type locality. USA: North Dakota, Slope Co., East River Road, ca. 1.75 mi from Burning Coal Vein Campground, elevation 2560’, GPS 46.597 5, −103.4568. Etymology. The name, a noun in the genitive case, honors Bill Dempwolf, the collector of the type series and a friend of the author. An exceptional lepidopterist, Bill is recognized for meticulously curating and assembling one of the finest collections. His generosity has been instrumental in our genomic studies, manifested through both dedicated specimen collection for our lab research and open access to his entire collection for leg sampling and sequencing. His profound contributions to our projects are highly significant and greatly appreciated. Distribution. Northeastern parts of the range, east of the Rockies from Alberta and Saskatchewan in Canada to North Dakota in the U.S.

Abstract: (Uploaded by Plazi from the Biodiversity Heritage Library) No abstract provided.

Abstract: nana nana (Fallén), 1820: 15 (Sciomyza) [Johnson 1925: 250] ST: 1♂ 1♀ Sweden, Esperöd. NHRS, unnumbered DIST: MEXICO (Baja California; Ciudad de México; Puebla: Huachinango; Tamaulipas). Also CANADA and UNITED STATES. The nominate subspecies, Ph. nana reticulata (Thomson), occurs throughout Europe. Map: Bratt et al. 1969 FIGS: Wulp 1897 (wing), Cresson 1920 (head, wing), Fisher & Orth 1983 (♂ terminalia), Foote et al. 1999 (wing), Foote & Keiper 2004 (habitus, wing), Knutson & Vala 2011 (wing), this paper (dorsal head) BIOL: Bratt et al. 1969. BG: 2; PG: 1 HOSTS/PREY OF LARVAE: In North America and Europe: freshwater (seven genera) and terrestrial (four genera) pulmonate snails [larvae and puparia in Galba humilis, Gyraulus parvus, Physa sp., and Stagnicola elodes (Bratt et al. 1969)] IMMATS: Bratt et al. 1969 (E, L1–L3, P) CHR: Boyes et al. 1969 (karyotype) MOL_DAT: Y transducta Walker, 1861: 320 (Sciomyza) [Steyskal 1965b: 686] HT:? “ United States.” NHMUK, unnumbered

Abstract: Genus Aphelinoidea Girault, 1911 Aphelinoidea Girault, 1911: 2–4. Type species: Aphelinoidea semifuscipennis Girault, by orig. des. Aphelinoidea Girault: Pinto 2006: 87–89 (taxonomic history, list of synonyms, diagnosis, distribution, diversity, discussion, list of New World records, hosts). Among the Trichogrammatidae, Aphelinoidea species can be recognized using the keys in Doutt and Viggiani (1968), Pinto (2006) and Fursov (2007). See Doutt and Viggiani (1968), Trjapitzin (1995), Walker et al. (2005), Fursov (2007), and particularly Pinto (2006) for the taxonomic history of the genus and its diagnosis, and also for the diagnoses of the recognized subgenera and species groups within the nominate subgenus. Pinto (2006) also provided an important discussion and good illustrations. The currently recognized subgenera and species groups in the nominate subgenus of Aphelinoidea occurring in the Palearctic region are keyed below. The identities of the European species A. laticlavia Fursov and A. stepposa Fursov,­very­briefly­described­in­the­key­to­the­ten­Palearctic­species­of­ Aphelinoidea (Fursov 2007) without mentioning some crucial morphological features, such as relative length of the ovipositor (this is an improper way to describe new taxa), are not clear to me. Without access to their holotype females or, at least, their digital images­(my­ request­ for­ these­ has­ not­ been­ fulfilled),­it­ is­ impossible­ to­ includethem in the key to the Palearctic species of Aphelinoidea below. Recognition of species in the A. (Aphelinoidea) plutella ­species­ group­ is­ very­ difficult­(andoften practically impossible without supporting genetic data, which are currently lacking)­ to­ separate­ from­ each­ other,­ and­ identification­ of­ A. laticlavia and A. stepposa is problematic in the absence of their full description and digital images of the primary types, even though the original illustrations are good. As shown here, even with availability of the very detailed original descriptions, as well as images and measurements of Nowicki’s type specimens, some species from this group are still almost impossible to diagnose properly. As noted by Rakitov and Triapitsyn (2013), users of the key in Fursov (2007), which they partially translated and­slightly­modified,­need­to­keep­in­mind­that­proportions­of­the­clava­and­itstwo segments (length: width ratios) as well as other antennomeres vary, often substantially, within the same species, and thus seem to be quite similar among some of the already described species in the plutella group (Table 1). Moreover, Fursov’s descriptions were not based on the examination of the type material of the Nowicki species, and neither was my own previous key (Trjapitzin 1995). The way specimens are dried or mounted on a slide (particularly orientation of the clava)­also­may,­potentially­significantly,­affect­these­ratios,­especially­if­the­antennae are not in a perfect lateral view or shriveled. Thus, describing any new taxa in this species group based solely on the ratios of antennal segments should be discouraged in the absence of other distinguishing morphological characters and supporting molecular evidence, which would be particularly helpful for separation of the already known species. I expect that once such information becomes available, some of them would eventually need to be synonymized.

Abstract: People who hold essentialist beliefs about gender attribute social differences between women and men to biological causes. The notion that gender differences are innate and therefore fixed may contribute to the STEM gender gap. This study examined, through two online experiments, whether priming participants with information about the causes of gender differences in math abilities influences their endorsement of gender stereotypes, attitudes toward science and women in science, and gender bias. The experiments were conducted with a sample of Italian young people aged 17 to 20. Participants were randomly assigned to read one of three articles addressing the gender gap in math abilities, which framed the cause as biological, social, or indicated no difference. The findings suggest no significant differences among the three groups in attitudes toward science or women in science. However, women exposed to the biological explanation exhibited stronger gender stereotypes than those in the social explanation condition. Additionally, in the second experiment, female students described as interested in STEM were consistently perceived as more atypical than their peers, regardless of the treatment condition. Finally, participants in both the "no difference" and "biological" treatment groups were more likely to nominate male students over female students for a hypothetical math and science competition.

Abstract: Ochlodes (Ochluma) sylvanoides paranapa Grishin, new subspecies http://zoobank.org/ ADC1FE05-7B71-4C9D-B788-64E7A2F82FE2 (Figs. 19 part, 20 part, 21b–d) Definition and diagnosis. Genomic analysis reveals that populations from the northeastern part of the range, historically identified as Ochlodes napa (W. H. Edwards, 1865) (type locality in USA: Colorado, Clear Creek Co.), are not in the same clade with this species but instead belong to Ochlodes (Ochluma) sylvanoides (Boisduval, 1852) (type locality in USA: California, Plumas Co.), being genetically differentiated from others at the subspecies level (Fig. 20a magenta and violet). While their COI barcodes (or mitogenomes, Fig. 20b) do not consistently differ, these populations together form a distinct moderately supported (88% bootstrap value) clade in the nuclear genome tree (Fig. 20a) that partitions into two more strongly supported subclades: northeastern (Fig. 20a violet, 93% bootstrap) and southwestern (Fig. 20a magenta, 100% bootstrap). The southwestern clade is most strongly differentiated genetically (longer branch) and supported statistically (100%) encompassing specimens from a wide geographical area spanning three states (Montana, Wyoming, and South Dakota) (Fig. 19 magenta). In addition to differences in DNA, these specimens are characterized by phenotypic differences from the nominate subspecies (due to which they were misidentified as O. napa), and, therefore, represent a new subspecies of O. sylvanoides. This new subspecies keys to “ Ochlodes sylvanoides napa ” (M.19.2(c)) in Evans (1955), but differs from it and other relatives by the following combination of characters: paler below, with a weaker pattern (Fig. 21b–d) than typical for the nominate subspecies (Fig. 21a), i.e., brown borders above are narrower, paler, and more diffuse at the edges; the ventral side is yellower (instead of redder) and usually with a more weakly defined brownish or reddish pattern, but typically more prominent than in O. napa (Fig. 21g –j) postdiscal pale bands on both wings; dorsally slightly darker than O. napa, with a stronger contrast between brown and orange areas and broader dorsal hindwing brown margins with more strongly developed brown overscaling over the orange areas between inverted brown triangles. Due to extensive individual variation in wing patterns, this subspecies is best identified by DNA, with diagnostic base pairs in the nuclear genome: aly275184.2.3:C501T, aly275184.2.3:C885T, aly 2085.1.10: A675G, aly 2085.1.10:C678T, aly 1846.1.1:C185A; and the COI barcode does not distinguish this subspecies from others. Barcode sequence of the holotype. Sample NVG-24126C06, GenBank PV892290, 658 base pairs: AACTTTATACTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGCGATGACCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAA TAAATAATATAAGATTTTGAATATTACCTCCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTATATCCTCCTTTATCTTCTAATATTGC TCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCTATTCTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGAATTAAAAACTTATCA TTTGATCAAATACCCTTATTTGTATGATCAGTAGGTATTACAGCATTATTATTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACAATATTACTTACTGATCGAAATTTAAATACTT CTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 21b, bears the following five printed (handwritten text in italics) rectangular labels, four white: [WY WASHAKIE Co. | T47N R86W S5 | Tensleep Reserve | 6400' 11-12.viii.98], [Allyn Museum | Acc. 1998-15], [Ochlodes sylvanoides | (Boisduval, 1852) ♂ | Det. S.R. Steinhauser], [DNA sample ID: | NVG-24126C06 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Ochlodes sylvanoides | paranapa Grishin]. Paratypes: 4♂♂ and 1♀ from USA in MGCL: Montana, Big Horn Co.: 1♂ NVG-24126B10 foothills of Pryor Mts., along Sage Creek, 5550’, 45.227 2, −108.585 6, 13-Aug-1997, Chuck & Chris Harp leg. (Fig. 21c) and 1♀ NVG-24126B12 25 mi SW of Lodge Grass, 6-Sep-1971, Jack Harry leg.; 1♂ NVG-24126C01 Wyoming, Big Horn Co., Red Grade Spring, 5000’, 13-Aug-1954; and South Dakota: 1♂ NVG-24127A08 Butte Co., USH212 at mi 17, ca. 2 mi E of Belle Fourche, 3-Aug-1983, D. L. Eiler leg. (Fig. 21d) and 1♂ NVG-24127A07 Lawrence Co., no locality details, 27-Aug-1969, M. L. May. Type locality. USA: Wyoming, Washakie Co., Bighorn Mountains, Tensleep Preserve, elevation 6400 ft. Etymology. The name reflects a superficial resemblance between O. napa and this new subspecies of O. sylvanoides, as it parallels O. napa but occurs at more northern latitudes. The name is treated as a noun in apposition. Distribution. Currently known from east of the main Rocky Mountain chain in Montana and Wyoming, and from South Dakota.

Abstract: C. beaufortia charlesi (Dickson 1970), Poecilmitis beaufortia charlesi Dickson, 1970: 93. Holotype: NHM, London. Type locality: “Quagga Fontein, 25 miles N.W of Sutherland”. Although variable, this is a much darker subspecies, often with an almost black forewing. It occurs on upper montane slopes from its type locality on the Roggeveldberge close to the NC Province and Tankwa Karoo boundary and northward to Kieske Mt. (within 17 km of Hantamsberg, Calvinia). Host ant and host plant as in nominate subspecies. Conservation status: LC – Rare.

Abstract: The influence of congressional primary elections on candidate positioning remains disputed and poorly understood. We test whether candidates communicate artificially “extreme” positions during the nomination, as revealed by moderation following a primary defeat. We apply a scaling method based on candidates language on Twitter to estimate positions of 988 candidates in contested US House of Representatives primaries in 2020 over time, demonstrating validity against NOMINATE (r > 0.93) where possible. Losing Democratic candidates moderated significantly after their primary defeat, indicating strategic position-taking for perceived electoral benefit, where the nomination contest induced artificially “extreme” communication. We find no such effect among Republicans. These findings have implications for candidate strategy in two-stage elections and provide further evidence of elite partisan asymmetry.

Abstract: (Uploaded by Plazi from the Biodiversity Heritage Library) No abstract provided.

Abstract: Chrysoritis lyncurium (Trimen 1868) Zeritis lyncurium Trimen 1868. Holotype: NHM, London. Type locality: “ Nr. Tsomo River.” The nominate subspecies is known from a few widely separated localities, from Mbulu near Tsomo in the Eastern Cape, to Kokstad and Bushmans Nek in the southern KZN Drakensberg. Host ant: Crem. liengmei. Taxonomy: This species is sister to C. aethon + C. aureus. Conservation status of C. l. lyncurium: VU.

Abstract: Introduction: Rapid stroke diagnosis is critical in the early stages to initiate stroke subtype-specific treatment soon after symptom onset. Objectives: We undertook a cross-platform proteomics study to discover plasma biomarkers of stroke diagnosis in emergency room (ER) settings. Methods: We analyzed clinical and proteomics data from stroke patients aged ≥18 years using a prospective plasma repository from 2010 to 2014. Blood samples were collected at admission to the ER before any therapeutic intervention. Our outcomes were differentially expressed protein (DEP) levels between patients with acute ischemic stroke (AIS), intracerebral hemorrhage (ICH), transient ischemic attack (TIA), and stroke mimics (MIM). We performed aptamer-based proteomics using the plasma 7K SomaScan assay. For pairwise comparisons, we identified the DEPs using ±1.5-fold change and unadjusted p-value <0.05 cut-offs, Boruta random forest feature selection, and variance partitioning analyses. We identified the top proteins and conducted multivariable logistic regression analyses. For multigroup comparisons, we performed feature selection by sparse partial least squares discriminant analysis (sPLS-DA) using the mixOmics R package. We conducted internal validation on the same samples using the PeptiQuant Plus biomarker assessment kits (BAK-270) for targeted protein quantitation (Figure 1). Results: We included 100 patients (mean age 58.6 years, 43% males) classified into four subgroups: 40 AIS, 20 ICH, 20 TIA, and 20 MIM (Figure 2). SomaScan quantified 7307 somamers targeting 6373 unique proteins. Using pairwise and multigroup comparisons, we nominated the top 58 proteins that differentiated the stroke subtypes. We identified a panel of 7 proteins as top AIS classifiers (area under the curve (AUC): 0.82, negative predictive value (NPV): 74%), 5 proteins as top ICH classifiers (AUC 0.88, NPV: 90%), 8 proteins as top MIM classifiers (AUC 0.94, NPV: 94%), and 6 proteins as top TIA classifiers (AUC 0.94, NPV: 91%) (Figure 3). In the validation phase, targeted proteomics validated VTN and PLG as top MIM classifiers against AIS, ICH, and TIA. Conclusions: Our exploratory study highlights plasma proteomics as a valuable tool for discovering protein biomarkers for stroke diagnosis. Further research is warranted to validate these findings in larger multi-center cohorts and to elucidate their clinical utility in ER settings for guiding therapeutic decision-making and improving patient outcomes.

Abstract: The role of circulating tumor DNA (ctDNA) in total neoadjuvant therapy (TNT) and non-operative management (NOM) for locally advanced rectal cancer (LARC) remains unclear. We evaluated the association of ctDNA with clinical outcomes, including treatment response, local regrowth, and distant recurrence in patients undergoing TNT and NOM. This biomarker companion analysis of the NOMINATE trial, a prospective, multicenter, randomized phase II study, enrolled 64 patients with T3-T4NanyM0 LARC between March 2021 and July 2023. Plasma samples (n=412) were collected at multiple time points: pre-treatment (T0), interim evaluations (T1, T2), final re-staging (T3), post-surgery or post-NOM (T4 and beyond). ctDNA was monitored using a tumor-informed mPCR-NGS assay (Signatera™). The association between ctDNA status and clinical outcomes was analyzed. Baseline ctDNA detection was 98.4%, decreasing to 32% at T1, 15% at T2, 30% at T3, and 5% at T4. Among 25 patients achieving clinical complete response (cCR) or near cCR with NOM, ctDNA clearance was 100% at T2-T4, whereas 39 non-cCR patients showed lower clearance rates (75% at T2, 51% at T3). ctDNA at T3 had 100% specificity and positive predictive value for pathological residual disease and was associated with shorter disease-free survival (HR 6.7, P = .005). Local regrowth occurred in five NOM patients, with ctDNA detected in two during surveillance. This study highlights the potential of ctDNA as a predictive and prognostic biomarker in LARC patients undergoing TNT and subsequently managed by NOM. However, the modest sensitivity of ctDNA highlights the need for technological improvements.

Abstract: Genus Indoribates Jacot, 1929: 429 Nixozetes Mahunka, 1977: 268 Sundazetes Hammer, 1979: 61; Mahunka 1987: 812 (synonym of Nixozetes); Balogh & Balogh 1992: 135 (synonymy). Bolkiah Mahunka, 1997: 692; Ermilov et al. 2019: 471 (synonymy). Type species. Protoribates punctulatus Sellnick, 1925 General remarks According to Subías’s system (Subías 2020, 2022; Subías & Shtanchaeva 2023), the main difference between the genera Indoribates and Lauritzenia is the number of genital setae. Indoribates has five pairs of genital setae, while Lauritzenia has four pairs (e.g., Balogh & Balogh 1992; Hammer 1958, 1979; Jacot 1929; Mahunka 1977, 1997; Subías 2020; Subías & Shtanchaeva 2023). Subías (2020) and Subías and Shtanchaeva (2023) stated that the genus Indoribates comprises five subgenera, including the nominate subgenus Indoribates and subgenus Bihaplozetes Subías, 2020. Species of the subgenus Indoribates have monodactylous legs, while Bihaplozetes is characterized by bidactylous legs (Subías 2020; Subías & Shtanchaeva 2023). The new species we describe in this paper have monodactylous legs I and bidactylous legs II to IV. The leg characteristics of the new species lie between those of the subgenus Indoribates and Bihaplozetes. Therefore, we suggest augmenting the diagnosis of the subgenus Indoribates to include the species with monodactylous or bidactylous legs, in order to avoid identification confusion. And we propose that Bihaplozetes is a junior synonym of the subgenus Indoribates: Indoribates (Indoribates) Jacot, 1929 (= Indoribates (Bihaplozetes) Subías, 2020 syn. nov.). According to Subías’s system (Subías 2020, 2022; Subías & Shtanchaeva 2023), the genus Lauritzenia comprises four subgenera, including the nominate subgenus Lauritzenia and subgenus Incabates. The most important difference between them is that the legs are monodactylous in the nominate subgenus, and heterotridactylous in Incabates (Balogh & Balogh 1992; Subías 2020; Subías & Shtanchaeva 2023). However, in the catalogue of Subías (2022, updated 2024), some species do not conform to these characteristics. For ease of identification, we propose revising the classification of certain species. Indoribates (Indoribates) carneus (Tseng, 1984), listed in the catalogue of Subías (2022, updated 2024), has four pairs of genital setae according to the original illustration. Additionally, the species has monodactylous legs, as per the diagnosis of Lauritzenia described by Tseng (1984). Therefore, the species should be placed in Lauritzenia (Lauritzenia). Indoribates (Indoribates) nobilis (Golosova, 1984) listed in the catalogue of Subías (2022, updated 2024), has four pairs of genital setae. Thus, it should be removed from the genus Indoribates. Golosova (1984) did not describe the legs of the species, but it was originally described in the genus Cosmobates Balogh, 1959, in which the species has heterotridactylous legs. Therefore, it is inferred that the legs of species nobilis are also heterotridactylous, and the species should be placed in Lauritzenia (Incabates). Thus, a new combination is proposed: Lauritzenia (Incabates) nobilis (Golosova, 1984) comb. nov. Indoribates (Haplozetes) albidus (Ewing, 1908), listed in the catalogue of Subías (2022, updated 2024), was once placed in the genus Scheloribates Berlese, 1908 by examining the syntype (Marshall et al. 1987). However, Subías (2004) placed it in the genus Protoribates Berlese, 1908 without any comments, and later, he placed it in Indoribates. Here, we agree with the view of Marshall et al. (1987) and the species should not be placed in the family Haplozetidae. Lauritzenia (Lauritzenia) cuticulata (Tseng, 1984), listed in the catalogue of Subías (2022, updated 2024), was originally placed in the genus Muliercula Coetzer, 1968, in which the pteromorphs of the species lack hinges. Tseng (1984) also stated that this species is similar to the other species, Muliercula chiayiensis Tseng, 1984, described in the same genus and paper, whose pteromorphs also lack hinges. Therefore, it is inferred that the pteromorphs of the species cuticulata lack hinges, and it should not be placed in Indoribates (Haplozetes). Meanwhile, due to the absence of the type specimens (Ermilov & Liao 2017), it may be better to keep it in the genus Muliercula.

Abstract: Clausilia plicatula var. albinos Roffiaen, 1868 Clausilia plicatula var. albinos Roffiaen, 1868: 76. Type material. Single specimen, at present not located. Type locality. Switzerland: Iseltwald. Taxonomic status. Junior synonym of Macrogastra plicatula plicatula (Draparnaud, 1801). Discussion. No specimens belonging to this taxon were found. The original description mentioned a single shell, whitish and transparent (hence, “ albinos ”), as belonging to this variety, while commenting that the nominate form is common and very variable (Roffiaen 1868: 76). Thus, this variety based on an albino specimen (or otherwise presenting partial or total loss of pigments) can be considered synonymous with the nominate form. Macrogastra plicatula is widespread in Europe, including many records in the area encompassing Iseltwald representing M. p. plicatula (Turner et al. 1998; Nordsieck 2006).

Abstract: Ochlodes (Ochluma) sylvanoides paranapa Grishin, new subspecies http://zoobank.org/ ADC1FE05-7B71-4C9D-B788-64E7A2F82FE2 (Figs. 19 part, 20 part, 21b–d) Definition and diagnosis. Genomic analysis reveals that populations from the northeastern part of the range, historically identified as Ochlodes napa (W. H. Edwards, 1865) (type locality in USA: Colorado, Clear Creek Co.), are not in the same clade with this species but instead belong to Ochlodes (Ochluma) sylvanoides (Boisduval, 1852) (type locality in USA: California, Plumas Co.), being genetically differentiated from others at the subspecies level (Fig. 20a magenta and violet). While their COI barcodes (or mitogenomes, Fig. 20b) do not consistently differ, these populations together form a distinct moderately supported (88% bootstrap value) clade in the nuclear genome tree (Fig. 20a) that partitions into two more strongly supported subclades: northeastern (Fig. 20a violet, 93% bootstrap) and southwestern (Fig. 20a magenta, 100% bootstrap). The southwestern clade is most strongly differentiated genetically (longer branch) and supported statistically (100%) encompassing specimens from a wide geographical area spanning three states (Montana, Wyoming, and South Dakota) (Fig. 19 magenta). In addition to differences in DNA, these specimens are characterized by phenotypic differences from the nominate subspecies (due to which they were misidentified as O. napa), and, therefore, represent a new subspecies of O. sylvanoides. This new subspecies keys to “ Ochlodes sylvanoides napa ” (M.19.2(c)) in Evans (1955), but differs from it and other relatives by the following combination of characters: paler below, with a weaker pattern (Fig. 21b–d) than typical for the nominate subspecies (Fig. 21a), i.e., brown borders above are narrower, paler, and more diffuse at the edges; the ventral side is yellower (instead of redder) and usually with a more weakly defined brownish or reddish pattern, but typically more prominent than in O. napa (Fig. 21g –j) postdiscal pale bands on both wings; dorsally slightly darker than O. napa, with a stronger contrast between brown and orange areas and broader dorsal hindwing brown margins with more strongly developed brown overscaling over the orange areas between inverted brown triangles. Due to extensive individual variation in wing patterns, this subspecies is best identified by DNA, with diagnostic base pairs in the nuclear genome: aly275184.2.3:C501T, aly275184.2.3:C885T, aly 2085.1.10: A675G, aly 2085.1.10:C678T, aly 1846.1.1:C185A; and the COI barcode does not distinguish this subspecies from others. Barcode sequence of the holotype. Sample NVG-24126C06, GenBank PV892290, 658 base pairs: AACTTTATACTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGCGATGACCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAA TAAATAATATAAGATTTTGAATATTACCTCCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTATATCCTCCTTTATCTTCTAATATTGC TCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCTATTCTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGAATTAAAAACTTATCA TTTGATCAAATACCCTTATTTGTATGATCAGTAGGTATTACAGCATTATTATTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACAATATTACTTACTGATCGAAATTTAAATACTT CTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 21b, bears the following five printed (handwritten text in italics) rectangular labels, four white: [WY WASHAKIE Co. | T47N R86W S5 | Tensleep Reserve | 6400' 11-12.viii.98], [Allyn Museum | Acc. 1998-15], [Ochlodes sylvanoides | (Boisduval, 1852) ♂ | Det. S.R. Steinhauser], [DNA sample ID: | NVG-24126C06 | c/o Nick V. Grishin], and one red [HOLOTYPE ♂ | Ochlodes sylvanoides | paranapa Grishin]. Paratypes: 4♂♂ and 1♀ from USA in MGCL: Montana, Big Horn Co.: 1♂ NVG-24126B10 foothills of Pryor Mts., along Sage Creek, 5550’, 45.227 2, −108.585 6, 13-Aug-1997, Chuck & Chris Harp leg. (Fig. 21c) and 1♀ NVG-24126B12 25 mi SW of Lodge Grass, 6-Sep-1971, Jack Harry leg.; 1♂ NVG-24126C01 Wyoming, Big Horn Co., Red Grade Spring, 5000’, 13-Aug-1954; and South Dakota: 1♂ NVG-24127A08 Butte Co., USH212 at mi 17, ca. 2 mi E of Belle Fourche, 3-Aug-1983, D. L. Eiler leg. (Fig. 21d) and 1♂ NVG-24127A07 Lawrence Co., no locality details, 27-Aug-1969, M. L. May. Type locality. USA: Wyoming, Washakie Co., Bighorn Mountains, Tensleep Preserve, elevation 6400 ft. Etymology. The name reflects a superficial resemblance between O. napa and this new subspecies of O. sylvanoides, as it parallels O. napa but occurs at more northern latitudes. The name is treated as a noun in apposition. Distribution. Currently known from east of the main Rocky Mountain chain in Montana and Wyoming, and from South Dakota.

Abstract: This study explores the relationships between primary school teachers' conceptions of giftedness, their nomination practices, and their ability to implement differentiated instruction, while examining the role of training on gifted education and teaching experience. Data were collected from 441 primary teachers in southeastern Turkey during the 2024-2025 academic year. Teachers' conceptions of giftedness, nomination practices, and differentiation strategies were assessed using the Gifted Child Perception Scale (GCPS) and the Differentiated Instruction Scale (DIS), with results analyzed through Pearson correlation and simple and multiple regression techniques. The findings indicated that teachers with broader conceptions of giftedness were more likely to nominate students with diverse abilities, including creativity and leadership, and to adopt more inclusive differentiation practices.Professional training in gifted education significantly predicted both nomination and differentiation competencies, while teaching experience was negatively associated with differentiation practices. As a correlational study, these findings reflect associations rather than causal relationships. The study highlights systemic challenges, such as limited access to training and resource constraints, which hinder teachers' ability to support gifted learners. Recommendations include integrating gifted education into training programs and providing resources to empower teachers. This research contributes to the literature on gifted education by emphasizing the link between teacher conceptions, training, and practices in nominating and supporting gifted students.

Abstract: Introduction: Attention is a fundamental cognitive function in sports, particularly in volleyball, where players must process multiple stimuli and make rapid decisions. Effective attentional control can enhance an athlete’s ability to react to dynamic game situations. The nomination of ideas strategy. Objective: This study aims to examine the effectiveness of the nomination of ideas strategy in enhancing divided and selective attention and its subsequent impact on volleyball skill performance. Methodology: A controlled experimental design was employed, involving volleyball players divided into an experimental group and a control group. The experimental group integrated the nomination of ideas strategy into their training sessions, while the control group followed traditional training methods. Pre- and post-tests were conducted to assess selective attention, divided attention, and volleyball skill performance, ensuring a comprehensive evaluation of cognitive and motor improvements. Discussion: The findings reveal that the experimental group exhibited significant improvements in both selective and divided attention, leading to enhanced volleyball skill performance compared to the control group. This suggests that implementing cognitive strategies such as the nomination of ideas can positively influence attentional focus, enabling athletes to process information more efficiently and execute complex skills with greater precision. Conclusion: The study underscores the value of integrating cognitive training techniques into sports practice to optimize both mental and physical performance. The nomination of ideas strategy proved to be an effective tool for improving attentional control and volleyball skills. Future research should investigate its long-term effects and potential applications across different sports and athlete populations.

Abstract: Genus Aphelinoidea Girault, 1911 Aphelinoidea Girault, 1911: 2–4. Type species: Aphelinoidea semifuscipennis Girault, by orig. des. Aphelinoidea Girault: Pinto 2006: 87–89 (taxonomic history, list of synonyms, diagnosis, distribution, diversity, discussion, list of New World records, hosts). Among the Trichogrammatidae, Aphelinoidea species can be recognized using the keys in Doutt and Viggiani (1968), Pinto (2006) and Fursov (2007). See Doutt and Viggiani (1968), Trjapitzin (1995), Walker et al. (2005), Fursov (2007), and particularly Pinto (2006) for the taxonomic history of the genus and its diagnosis, and also for the diagnoses of the recognized subgenera and species groups within the nominate subgenus. Pinto (2006) also provided an important discussion and good illustrations. The currently recognized subgenera and species groups in the nominate subgenus of Aphelinoidea occurring in the Palearctic region are keyed below. The identities of the European species A. laticlavia Fursov and A. stepposa Fursov,­very­briefly­described­in­the­key­to­the­ten­Palearctic­species­of­ Aphelinoidea (Fursov 2007) without mentioning some crucial morphological features, such as relative length of the ovipositor (this is an improper way to describe new taxa), are not clear to me. Without access to their holotype females or, at least, their digital images­(my­ request­ for­ these­ has­ not­ been­ fulfilled),­it­ is­ impossible­ to­ includethem in the key to the Palearctic species of Aphelinoidea below. Recognition of species in the A. (Aphelinoidea) plutella ­species­ group­ is­ very­ difficult­(andoften practically impossible without supporting genetic data, which are currently lacking)­ to­ separate­ from­ each­ other,­ and­ identification­ of­ A. laticlavia and A. stepposa is problematic in the absence of their full description and digital images of the primary types, even though the original illustrations are good. As shown here, even with availability of the very detailed original descriptions, as well as images and measurements of Nowicki’s type specimens, some species from this group are still almost impossible to diagnose properly. As noted by Rakitov and Triapitsyn (2013), users of the key in Fursov (2007), which they partially translated and­slightly­modified,­need­to­keep­in­mind­that­proportions­of­the­clava­and­itstwo segments (length: width ratios) as well as other antennomeres vary, often substantially, within the same species, and thus seem to be quite similar among some of the already described species in the plutella group (Table 1). Moreover, Fursov’s descriptions were not based on the examination of the type material of the Nowicki species, and neither was my own previous key (Trjapitzin 1995). The way specimens are dried or mounted on a slide (particularly orientation of the clava)­also­may,­potentially­significantly,­affect­these­ratios,­especially­if­the­antennae are not in a perfect lateral view or shriveled. Thus, describing any new taxa in this species group based solely on the ratios of antennal segments should be discouraged in the absence of other distinguishing morphological characters and supporting molecular evidence, which would be particularly helpful for separation of the already known species. I expect that once such information becomes available, some of them would eventually need to be synonymized.

Abstract: Introduction: Atrial fibrillation (AFib) is a major risk factor for ischemic stroke (IS). AFib diagnosis is critical to optimize secondary prevention and reduce the recurrent stroke risk. Objectives: We undertook an exploratory cross-platform proteomics study to discover plasma biomarkers of AFib diagnosis in patients with IS or transient ischemic attack (TIA). Methods: We used clinical and proteomics data of stroke patients aged ≥18 years lodged within a prospective plasma repository from 2010 to 2014. We collected blood from each patient at hospital admission before administering any therapeutic intervention. Our outcome was differentially expressed levels of proteins in stroke patients with AFib compared to patients without AFib. We performed aptamer-based proteomics using the plasma 7K SomaScan assay. We identified the differentially expressed proteins using (i) ±1.5-fold change and unadjusted p-value <0.05 cut-offs, (ii) Boruta random forest-based machine learning algorithm, and (iii) 30% or more variation explained by AFib in variance partitioning analysis (VPA). We selected the top proteins that were identified using two of the three selection approaches and conducted multivariable adjusted analyses. We conducted internal validation on the same samples using the PeptiQuant Plus biomarker assessment kits (BAK-270) for targeted protein quantitation. Results: We included 60 patients with IS/TIA (mean age 62.9 years, 50% males) classified into 11 AFib and 49 no AFib (Figure 1). SomaScan quantified 7307 protein targets including 6373 unique proteins. We identified 171 differentially expressed proteins in stroke patients with AFib compared to no AFib. After adjusting for age, sex, diabetes, and coronary artery disease in the multivariable analysis, we identified 53 top proteins independently associated with AFib in stroke patients (adjusted p<0.05) (Figure 2). In the validation phase, we quantified 216 proteins using the BAK-270 platform, of which 185 proteins were overlapping with SomaScan. Using BAK-270, we validated increased levels of IGFBP2, B2M, and COL18A1 and decreased levels of CNDP1, AHSG, and SERPINA4 in stroke patients with AFib compared to no AFib (Figure 3). Conclusions: Our exploratory study highlights the potential of plasma proteomics as a valuable tool for discovering protein biomarkers to discriminate IS/TIA patients with AFib compared to no AFib. Further longitudinal studies with adequate sample sizes are needed to support these findings.

Abstract: While extensive research examines electoral systems and institutions at the country-level, few studies investigate rules within parties. Inside Parties changes the research landscape by systematically examining 65 parties in 20 parliamentary democracies around the world. Georgia Kernell develops a formal model of party membership and tests the hypotheses using cross-national surveys, member studies, experiments, and computer simulations of projected vote shares. She finds that a party's level of decentralization - the degree to which it incorporates rank and file members into decision making - determines which voters it best represents. Decentralized parties may attract more members to campaign for the party, but they do so at the cost of adopting more extreme positions that pull them away from moderate voters. Novel and comprehensive, Inside Parties is an indispensable study of how parties select candidates, nominate leaders, and set policy goals

Abstract: (Uploaded by Plazi from the Biodiversity Heritage Library) No abstract provided.

Abstract: We study the selection of agents based on mutual nominations, a theoretical problem with many applications from committee selection to AI alignment. As agents both select and are selected, they may be incentivized to misrepresent their true opinion about the eligibility of others to influence their own chances of selection. Impartial mechanisms circumvent this issue by guaranteeing that the selection of an agent is independent of the nominations cast by that agent. Previous research has established strong bounds on the performance of impartial mechanisms, measured by their ability to approximate the number of nominations for the most highly nominated agents. We study to what extent the performance of impartial mechanisms can be improved if they are given a prediction of a set of agents receiving a maximum number of nominations. Specifically, we provide bounds on the consistency and robustness of such mechanisms, where consistency measures the performance of the mechanisms when the prediction is accurate and robustness its performance when the prediction is inaccurate. For the general setting where up to $k$ agents are to be selected and agents nominate any number of other agents, we give a mechanism with consistency $1-O\big(\frac{1}{k}\big)$ and robustness $1-\frac{1}{e}-O\big(\frac{1}{k}\big)$. For the special case of selecting a single agent based on a single nomination per agent, we prove that $1$-consistency can be achieved while guaranteeing $\frac{1}{2}$-robustness. A close comparison with previous results shows that (asymptotically) optimal consistency can be achieved with little to no sacrifice in terms of robustness.

Abstract: (Uploaded by Plazi from the Biodiversity Heritage Library) No abstract provided.

Abstract: LOPHORINA SUPERBA ADDENDA IREDALE, 1948 Lophorina superba addenda Iredale, 1948, Australian Zoologist 11: 162 – type locality: Mt. Hagen District, central highlands of PNG. Range: eastern cordillera, between the Yuat– Strickland River Divide and head of the Papuan Peninsula, PNG, c. 1200–2200 m a.s.l., evidently intergrading with nominate superba westwards through the Lagaip-upper Kikori River drainages. Remarks: The subspecific name addenda Iredale (1948) was previously synonymized under the subspecies superba (Mayr, 1962, as feminina) or latipennis (Cracraft, 1992; Beehler & Pratt, 2016).

Abstract: Introduction: The National Institutes of Health Stroke Scale (NIHSS) provides a clinical measure of stroke severity. Molecular biomarkers that reflect severity of neurological injury may enhance the objectivity and accuracy of stroke severity assessment. Objectives: This study aimed to discover plasma proteins indicative of stroke severity in patients with acute ischemic stroke (AIS) using aptamer-based proteomics and supervised machine learning algorithms. Methods: We used clinical and proteomics data of AIS patients aged ≥18 years lodged within a prospective plasma repository from 2010 to 2014. We collected blood from each patient at hospital admission before administering any therapeutic intervention. Our outcome was differentially expressed levels of proteins in AIS patients classified by NIHSS scores. We classified AIS patients into mild NIHSS (0-7), moderate NIHSS (8-10), severe NIHSS (11-20), and critical NIHSS (21-42) subgroups. We performed aptamer-based proteomics using the plasma 7K SomaScan assay. For comparisons between the four NIHSS subgroups, we performed feature selection by sparse partial least squares discriminant analysis (sPLS-DA) using the MixOmics R package. We determined the area under the receiver operating characteristic curves (AUC-ROC) to classify the AIS-severity subgroups. Results: We included 40 AIS patients (mean age 63.3 years, 45% males) classified into four subgroups: 10 mild NIHSS, 9 moderate NIHSS, 11 severe NIHSS, and 10 critical NIHSS (Figure 1). SomaScan quantified 7307 protein targets, including 6373 unique proteins. Using the sPLS-DA approach, we identified two components classifying critical NIHSS (component 1, 10 proteins) and mild and severe NIHSS (component 2, 35 proteins) from moderate NIHSS. The panel of 45 proteins from the two components had an AUC of 0.96 to classify mild NIHSS, 0.66 to classify moderate NIHSS, 0.96 to classify severe NIHSS, and AUC of 0.97 to classify critical NIHSS from other subgroups. The top 5 proteins for AIS risk stratification were SELENOW, ANGPTL4, FABP3, CFL2, and KDM8 (Figure 2). Conclusions: Our study revealed distinct panels of protein biomarkers capable of classifying AIS patients into NIHSS-defined severity subgroups with high accuracy, particularly for mild, severe, and critical categories. These proteins may improve stroke severity assessment, especially in conditions where a clinical exam is limited, though further validation with larger cohorts is critically needed.