Hormone Responsive

Abstract: On Thursday,January2, 1997, Dr. HerbertSoule, the scientist who developed the MCF-7 breast cancer cell line, died. At the time, we were in the process of writingthis tributeto markthe 25th anniversary of Dr. Soule's remarkableaccomplishment.The cells, derived from a breast cancer patient in the Detroit area and developed at the Michigan CancerFoundation,Detroit,became a standardmodel in hundredsof laboratories around the world. In retrospect, the story of the diverse uses of these cells is really the history of our developing knowledge of hormone-regulatedcell replication, and they provided a unique insight into the endocrine therapyof breastcancer. Our article is offered as a tributeand memorial to Dr. Soule. We will trace researchwith MCF-7 cells to illustratethe change in our ideas about cell replication and to highlight the advances in our understanding of the signal transduction pathway of estrogen and the molecular biology of estrogen action. All of these advances depended on the uniquepropertiesof MCF-7 cells. Additionally,it is important to appreciate that the cell system has now found applications in experimental therapeutics, and the results from these studies are being translated to the clinic for the treatment of patients. None of this would have been possible withoutDr. Soule's skill as a cell biologist.

Abstract: The active hormonal form of vitamin D3, 1,25-dihydroxyvitamin D3[1,25(OH), which regulates cellular replication and function in many tissues and has a role in bone and calcium homeostasis, acts through a hormone receptor homologous with other steroid and thyroid hormone receptors. A 1,25(OH)2D3-responsive element (VDRE), which is within the promoter for osteocalcin [a bone protein induced by 1,25(OH)2D3] is unresponsive to other steroid hormones, can function in a heterologous promoter, and contains a doubly palindromic DNA sequence (TTGGTGACTCACCGGGTGAAC; -513 to -493 bp), with nucleotide sequence homology to other hormone responsive elements. The potent glucocorticoid repression of 1,25(OH)2D3 induction and of basal activity of this promoter acts through a region between -196 and +34 bp, distinct from the VDRE.

Abstract: The majority of breast cancers express the estrogen receptor (ERα) and agents targeting this pathway represent the main treatment modality. Endocrine therapy has proven successful in the treatment of hormone-responsive breast cancer since its early adoption in the 1940s as an ablative therapy. Unfortunately, therapeutic resistance arises, leading to disease recurrence and relapse. Recent studies increased our understanding in how changes to the chromatin landscape and deregulation of epigenetic factors orchestrate the resistant phenotype. Here, we will discuss how the epigenome is an integral determinant in hormone therapy response and why epigenetic factors are promising targets for overcoming clinical resistance. Endocrine therapy has been the mainstay for hormone responsive breast cancer treatment. Here, Garcia-Martinez and colleagues discuss epigenetic mechanisms regulating ER + breast cancer and endocrine therapy resistance, and highlight approaches to rewire the cancer epigenome to improve targeted therapies for this cancer.

Abstract: Virtually all of the physiologic effects of thyroid hormone are thought to be initiated by the binding of 3, 5,3'-triiodothyronine (T3) to DNA-binding proteins termed T3 receptors (T3R). Either positive or negative effects on gene transcription can be generated by the hormone/receptorlDNA complex, depending on the gene and target tissue. Proteins capable of conferring thyroid hormone responsiveness are now known to be coded for by two cellular homologues of the viral oncogene v-erbA, one of two oncogenes carried by the avian erythroblastosis virus (28, 32, 58, 71). The most global physiologic effect of thyroid hormone is stimulation of oxygen consumption. which appears to be the consequence of the additive effects of small changes in the levels of numerous rate-limiting enzymes. One of the most carefully studied thyroid hormone responsive proteins is rat growth hormone (rGH). In the rat, unlike the human, normal growth hormone synthesis rates require the presence of thyroid hormone. Samuels et al recent­ ly reviewed the biological studies of this protein, which indicate that the