TL;DR: It was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.
Abstract: Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.
TL;DR: Current knowledge of PrPC as a receptor for amyloid proteins and its physiological significance are summarized, with particular focus on α-synuclein.
Abstract: The term 'prion-like' is used to define some misfolded protein species that propagate intercellularly, triggering protein aggregation in recipient cells. For cell binding, both direct plasma membrane interaction and membrane receptors have been described for particular amyloids. In this respect, emerging evidence demonstrates that several β-sheet enriched proteins can bind to the cellular prion protein (PrPC). Among other interactions, the physiological relevance of the binding between β-amyloid and PrPC has been a relevant focus of numerous studies. At the molecular level, published data point to the second charged cluster domain of the PrPC molecule as the relevant binding domain of the β-amyloid/PrPC interaction. In addition to β-amyloid, participation of PrPC in binding α-synuclein, responsible for neurodegenerative synucleopathies, has been reported. Although results indicate relevant participation of PrPC in the spreading of α-synuclein in living mice, the physiological relevance of the interaction remains elusive. In this comment, we focus our attention on summarizing current knowledge of PrPC as a receptor for amyloid proteins and its physiological significance, with particular focus on α-synuclein.
TL;DR: A growing body of research supports the view that the prion-like molecular transformation of specific proteins drives the onset and course of a remarkable variety of clinicopathologically diverse diseases.
Abstract: The prion paradigm is increasingly invoked to explain the molecular pathogenesis of neurodegenerative diseases involving the misfolding and aggregation of proteins other than the prion protein (PrP). Extensive evidence from in vitro and in vivo studies indicates that misfolded and aggregated Aβ peptide, which is the probable molecular trigger for Alzheimer's disease, manifests all of the key characteristics of canonical mammalian prions. These features include a β-sheet rich architecture, tendency to polymerize into amyloid, templated corruption of like protein molecules, ability to form structurally and functionally variant strains, systematic spread by neuronal transport, and resistance to inactivation by heat and formaldehyde. In addition to Aβ, a growing body of research supports the view that the prion-like molecular transformation of specific proteins drives the onset and course of a remarkable variety of clinicopathologically diverse diseases. As such, the expanded prion paradigm could conceptually unify fundamental and translational investigations of these disorders.
TL;DR: Hypometabolism in brain areas related to some specific signs of Creutzfeldt-Jakob disease is seen, and this is in addition to lateralized frontal and parietal hypometabolic areas previously reported in CJD and observed here.
Abstract: Objective: To assess the relationship between clinical pattern and cerebral glucose metabolism on [18F]fluoro-2-deoxy-D-glucose positron emission tomography (FDG-PET) in Creutzfeldt-Jakob disease (...
TL;DR: The data on the amyloidogenic proteins of plants and their functions are systematized and the perspectives of identifying novel amyloids using bioinformatic and proteomic approaches are discussed.
Abstract: Amyloids represent protein fibrils that have highly ordered structure with unique physical and chemical properties. Amyloids have long been considered lethal pathogens that cause dozens of incurable diseases in humans and animals. Recent data show that amyloids may not only possess pathogenic properties but are also implicated in the essential biological processes in a variety of prokaryotes and eukaryotes. Functional amyloids have been identified in archaea, bacteria, fungi, and animals, including humans. Plants are one of the most poorly studied groups of organisms in the field of amyloid biology. Although amyloid properties have not been shown under native conditions for any plant protein, studies demonstrating amyloid properties for a set of plant proteins in vitro or in heterologous systems in vivo have been published in recent years. In this review, we systematize the data on the amyloidogenic proteins of plants and their functions and discuss the perspectives of identifying novel amyloids using bioinformatic and proteomic approaches.
TL;DR: It is demonstrated that in yeast, stress-inducible cytoskeleton-associated protein Lsb2 forms a metastable prion in response to high temperature, thus maintaining the memory of stress in a population of surviving cells.
Abstract: Amyloids and amyloid-based prions are self-perpetuating protein aggregates which can spread by converting a normal protein of the same sequence into a prion form They are associated with diseases in humans and mammals, and control heritable traits in yeast and other fungi Some amyloids are implicated in biologically beneficial processes As prion formation generates reproducible memory of a conformational change, prions can be considered as molecular memory devices We have demonstrated that in yeast, stress-inducible cytoskeleton-associated protein Lsb2 forms a metastable prion in response to high temperature This prion promotes conversion of other proteins into prions and can persist in a fraction of cells for a significant number of cell generations after stress, thus maintaining the memory of stress in a population of surviving cells Acquisition of an amino acid substitution required for Lsb2 to form a prion coincides with acquisition of increased thermotolerance in the evolution of Sacch
TL;DR: New evidence is presented showing that sustained stress granule formation triggers RBP aggregation and that mild chronic stress during aging promotes mislocalization of nuclear RBPs, highlighting how changes with age could contribute to pathogenesis in neurodegenerative diseases and disruption of RNA homeostasis.
Abstract: Low complexity (LC) prion-like domains are over-represented among RNA-binding proteins (RBPs) and contribute to the dynamic nature of RNA granules. Importantly, several neurodegenerative diseases are characterized by cytoplasmic "solid" aggregates formed by mainly nuclear RBPs harboring LC prion-like domains. Although RBP aggregation in disease has been extensively characterized, it remains unknown how the process of aging disturbs RBP dynamics. Our recent study revealed that RNA granule components including 2 key stress granule RBPs with LC prion-like domains, PAB-1 and TIAR-2, aggregate in aged Caenorhabditis elegans in the absence of disease. Here we present new evidence showing that sustained stress granule formation triggers RBP aggregation. In addition, we demonstrate that mild chronic stress during aging promotes mislocalization of nuclear RBPs. We discuss the consequences of aberrant interactions between age-related RBP aggregation and disease-associated RBP aggregation. In particular, we show that FUST-1 and PAB-1 co-localize in aberrant cytoplasmic accumulations. Significantly, long-lived animals with reduced insulin/IGF-1 signaling abrogate stress granule RBP aggregation through activation of the transcription factors HSF-1 and DAF-16. We evaluate the different mechanisms that could maintain dynamic stress granules. Together these findings highlight how changes with age could contribute to pathogenesis in neurodegenerative diseases and disruption of RNA homeostasis.
TL;DR: A novel flow cytometry technique (FloIT) is used to analyze TDP-43 inclusions and propagation and results imply the transfer of T DP-43 fusion proteins between cells and that this process can increase aggregation of wild-type TTP-43 by a mechanism involving co-aggregation with G294A TDP -43.
Abstract: Amyotrophic lateral sclerosis is a devastating neuromuscular degenerative disease characterized by a focal onset of motor neuron loss, followed by contiguous outward spreading of pathology including TAR DNA-binding protein of 43 kDa (TDP-43) aggregates. Previous work suggests that TDP-43 can move between cells. Here we used a novel flow cytometry technique (FloIT) to analyze TDP-43 inclusions and propagation. When cells were transfected to express either mutant G294A TDP-43 fused to GFP or wild type TDP-43fused to tomato red and then co-cultured, flow cytometry detected intact cells containing both fusion proteins and using FloIT detected an increase in the numbers of inclusions in lysates from cells expressing wild type TDP-43-tomato. Furthermore, in this same model, FloIT analyses detected inclusions containing both fusion proteins. These results imply the transfer of TDP-43 fusion proteins between cells and that this process can increase aggregation of wild-type TDP-43 by a mechanism involving co-aggregation with G294A TDP-43.
TL;DR: A well-controlled evaluation of a newly developed real-time quaking-induced conversion assay as a potential CWD diagnostic screening test using rectal biopsy sections from a depopulated elk herd shows a potential utility of the RT-QuIC assay to advance the development of a rapid, sensitive, and specific prion diagnostic assay for CWD prions.
Abstract: Prion diseases are transmissible spongiform encephalopathies (TSEs) characterized by fatal, progressive neurologic diseases with prolonged incubation periods and an accumulation of infectious misfolded prion proteins. Antemortem diagnosis is often difficult due to a long asymptomatic incubation period, differences in the pathogenesis of different prions, and the presence of very low levels of infectious prion in easily accessible samples. Chronic wasting disease (CWD) is a TSE affecting both wild and captive populations of cervids, including mule deer, white-tailed deer, elk, moose, muntjac, and most recently, wild reindeer. This study represents a well-controlled evaluation of a newly developed real-time quaking-induced conversion (RT-QuIC) assay as a potential CWD diagnostic screening test using rectal biopsy sections from a depopulated elk herd. We evaluated 69 blinded samples of recto-anal mucosa-associated lymphoid tissue (RAMALT) obtained from USDA Veterinary Services. The results were later un-blinded and statistically compared to immunohistochemical (IHC) results from the USDA National Veterinary Services Laboratories (NVSL) for RAMALT, obex, and medial retropharyngeal lymph node (MRPLN). Comparison of RAMALT RT-QuIC assay results with the IHC results of RAMALT revealed 92% relative sensitivity (95% confidence limits: 61.52-99.8%) and 95% relative specificity (95% confidence limits: 85.13-99%). Collectively, our results show a potential utility of the RT-QuIC assay to advance the development of a rapid, sensitive, and specific prion diagnostic assay for CWD prions.
TL;DR: This work sequenced Prnp of woodland caribou from 9 Albertan populations and found that in one population (Chinchaga) a significantly higher frequency of the 138N allele linked to reduced CWD susceptibility was observed.
Abstract: Chronic wasting disease (CWD) is a prion disease found in deer, elk and moose in North America and since recently, wild reindeer in Norway. Caribou are at-risk to encounter CWD in areas such as Alberta, Canada, where the disease spreads toward caribou habitats. CWD susceptibility is modulated by species-specific polymorphisms in the prion protein gene (Prnp). We sequenced Prnp of woodland caribou from 9 Albertan populations. In one population (Chinchaga) a significantly higher frequency of the 138N allele linked to reduced CWD susceptibility was observed. These data are relevant for developing CWD management strategies including conservation of threatened caribou populations.
TL;DR: This study supports the use of FDG-PET in the assessment of CJD and provides more evidence about the behavioral of amyloid tracers, and the possibility of a low-affinity binding to other non-amyloid proteins, such as the pathological prion protein, is discussed.
Abstract: Introduction. The role of positron emission tomography (PET) in Creutzfeldt-Jakob disease is less defined than in other neurodegenerative diseases. We studied the correlation between the uptake of 18F-florbetaben and 18F-fluorodeoxyglucose with pathological prion protein deposition in histopathology in a case.Methods. A patient with 80 y old with a rapid neurological deterioration with a confirmed diagnosis of CJD was studied. PET and MRI studies were performed between 13–20 d before the death. A region of interest analysis was performed using Statistical Parametric Mapping.Results. MRI showed atrophy with no other alterations. FDG-PET showed extensive areas of hypometabolism including left frontoparietal lobes as well as bilateral thalamus. Correlation between uptake of 18F-florbetaben and pathological prion protein deposition was r = 0.786 (p < 0.05). Otherwise, correlation between uptake of 18F-FDG and pathological prion protein was r = 0.357 (p = 0.385). Immunohistochemistry with β-amyloid did...
TL;DR: This case indicates that convulsion may cause false-positive RT-QUIC results, and that a postmortem evaluation remains the gold standard for diagnosing similar cases.
Abstract: We report an autopsy-verified case of steroid-responsive encephalopathy with convulsion and a false-positive result from the real-time quaking-induced conversion (RT-QUIC) assay. A 61-year-old Japanese man presented with acute onset of consciousness disturbance, and convulsions, but without a past medical or family history of progressive dementia, epilepsy, or prion disease. Brain diffusion and fluid-attenuated inverted recovery MR images revealed edematous cortical hyper-intensity, which diminished after the acute phase. Steroid pulse therapy was partially effective, although he continued to have dementia with myoclonus and psychiatric symptoms, despite resolution of the consciousness disturbance. Cerebrospinal fluid (CSF) analysis revealed a normal cell count, with significantly elevated levels of 14–3–3 protein and total tau protein. In addition, prion protein in the CSF was slowly amplified by the RT-QUIC assay. PRNP gene analysis revealed methionine homozygosity at codon 129 without mutation....
TL;DR: It is found that patients undergoing gastrostomy required significantly fewer discontinuations of tube feeding than those who did not, and no significant difference in antibiotic administration was found between groups, however.
Abstract: Patients with prion diseases can live for long periods of time in a state of akinetic mutism given appropriate management of their symptoms. To study symptom support in these cases, we performed gastrostomies on 3 patients with V180I genetic Creutzfeldt-Jakob disease (CJD) who had become akinetic and mute, and compared them to 14 other similar patients being fed by tube. In the 3 gastrostomy cases, there were no direct complications due to the gastrostomy or tube feeding, nor were there episodes of discontinuation of tube feeding or initiation of continuous drip infusion due to severe complications. Antibiotics were administered for mild infections, a complication of CJD, with 0.2% and 8.8% of the total time after gastrostomy being used for intravenous or transluminal administration, respectively. We compared the present patient series with that of our previous report statistically, and found that patients undergoing gastrostomy required significantly fewer discontinuations of tube feeding than th...
TL;DR: It is hypothesized that short, sequence-specific, amyloid cores embedded in PFDs can perform these functions and, accordingly, act as preferential nucleation centers in both spontaneous and seeded aggregation.
Abstract: Despite the significant efforts devoted to decipher the particular protein features that encode for a prion or prion-like behavior, they are still poorly understood. The well-characterized yeast prions constitute an ideal model system to address this question, because, in these proteins, the prion activity can be univocally assigned to a specific region of their sequence, known as the prion forming domain (PFD). These PFDs are intrinsically disordered, relatively long and, in many cases, of low complexity, being enriched in glutamine/asparagine residues. Computational analyses have identified a significant number of proteins having similar domains in the human proteome. The compositional bias of these regions plays an important role in the transition of the prions to the amyloid state. However, it is difficult to explain how composition alone can account for the formation of specific contacts that position correctly PFDs and provide the enthalpic force to compensate for the large entropic cost of immobilizing these domains in the initial assemblies. We have hypothesized that short, sequence-specific, amyloid cores embedded in PFDs can perform these functions and, accordingly, act as preferential nucleation centers in both spontaneous and seeded aggregation. We have shown that the implementation of this concept in a prediction algorithm allows to score the prion propensities of putative PFDs with high accuracy. Recently, we have provided experimental evidence for the existence of such amyloid cores in the PFDs of Sup35, Ure2, Swi1, and Mot3 yeast prions. The fibrils formed by these short stretches may recognize and promote the aggregation of the complete proteins inside cells, being thus a promising tool for targeted protein inactivation.
TL;DR: A new model is proposed for Swa2's involvement in [URE3] propagation in which Swa 2 and Hsp90 mediate the formation of a multi-protein complex that increases the number of sites available for Hsp104 disaggregation.
Abstract: Yeast prions are protein-based genetic elements that propagate through cell populations via cytosolic transfer from mother to daughter cell Molecular chaperone proteins including Hsp70, the Hsp40/J-protein Sis1, and Hsp104 are required for continued prion propagation, however the specific requirements of chaperone proteins differ for various prions We recently reported that Swa2, the yeast homolog of the mammalian protein auxilin, is specifically required for the propagation of the prion [URE3] 1 [URE3] propagation requires both a functional J-domain and the tetratricopeptide repeat (TPR) domain of Swa2, but does not require Swa2 clathrin binding We concluded that the TPR domain determines the specificity of the genetic interaction between Swa2 and [URE3], and that this domain likely interacts with one or more proteins with a C-terminal EEVD motif Here we extend that analysis to incorporate additional data that supports this hypothesis We also present new data eliminating Hsp104 as the relevant Swa2 binding partner and discuss our findings in the context of other recent work involving Hsp90 Based on these findings, we propose a new model for Swa2's involvement in [URE3] propagation in which Swa2 and Hsp90 mediate the formation of a multi-protein complex that increases the number of sites available for Hsp104 disaggregation
TL;DR: The idea that any prion allele is a bimodular hereditary system that depends on a certain DNA sequence (DNA determinant) and a certain epigenetic mark (epigenetic determinant), which seems to be universal for any epigenetic hereditary factor.
Abstract: Modern biology requires modern genetic concepts equally valid for all discovered mechanisms of inheritance, either "canonical" (mediated by DNA sequences) or epigenetic. Applying basic genetic terms such as "gene" and "allele" to protein hereditary factors is one of the necessary steps toward these concepts. The basic idea that different variants of the same prion protein can be considered as alleles has been previously proposed by Chernoff and Tuite. In this paper, the notion of prion allele is further developed. We propose the idea that any prion allele is a bimodular hereditary system that depends on a certain DNA sequence (DNA determinant) and a certain epigenetic mark (epigenetic determinant). Alteration of any of these 2 determinants may lead to establishment of a new prion allele. The bimodularity principle is valid not only for hereditary prions; it seems to be universal for any epigenetic hereditary factor.
TL;DR: A new concept on the important role of strain-specific functional carbohydrate epitopes on the PrPSc surface as main determinants of strains-specific biologic features is introduced, which states that individual strain- specific folding patterns of PrP Sc govern selection of PrPC sialoglycoforms expressed by a host that can be accommodated within particular PrP sc structures.
Abstract: Among a broad range of hypotheses on the molecular nature of transmissible spongiform encephalopathy or scrapie agents discussed in 1960s was a hypothesis of self-replicating polysaccharides. While the studies of the past 40 years provided unambiguous proof that this is not the case, emerging evidence suggests that carbohydrates in the form of sialylated N-linked glycans, which are a constitutive part of mammalian prions or PrPSc, are essential in determining prion fate in an organism. The current extra-view article discusses recent advancements on the role of N-linked glycans and specifically their sialylation status in controlling prion fate. In addition, this manuscript introduces a new concept on the important role of strain-specific functional carbohydrate epitopes on the PrPSc surface as main determinants of strain-specific biologic features. According to this concept, individual strain-specific folding patterns of PrPSc govern selection of PrPC sialoglycoforms expressed by a host that can be accommodated within particular PrPSc structures. Strain-specific patterns of functional carbohydrate epitopes formed by N-linked glycans on PrPSc surfaces define strain-specific biologic features. As a constitutive part of PrPSc, the individual strain-specific patterns of carbohydrate epitopes propagate faithfully within a given host as long as individual strain-specific PrPSc structures are maintained, ensuring inheritance of strain-specific biologic features.
TL;DR: This case of a 76-year-old woman presenting with 47-month history of progressive dementia and cortical blindness with no family history did not meet with the probable WHO diagnostic criteria until 3 years after symptom onset, highlighting the difficulty of diagnosing a living case of the MM2-type of sCJD.
Abstract: We report the case of a 76-year-old woman presenting with 47-month history of progressive dementia and cortical blindness with no family history. Antibodies against thyroid glands and the N-terminus of α-enolase (NAE) were detected in her serum. Neurological examination revealed progressive dementia, frontal signs, visual disturbance, and exaggerated bilateral tendon reflexes in both legs. Diffusion MRI showed cortical hyper-intensities in the bilateral occipital and parietal, and the left frontal and temporal cortices. 99mTc-ethyl cysteinate dimer-single photon emission computed tomography indicated decreased regional cerebral blood flow throughout the bilateral parietal lobes and partially in the left frontal and temporal lobes. PRNP gene analysis showed no mutations with methionine homozygosity at codon 129 in peripheral blood. Cerebrospinal fluid examination, including 14-3-3 and total tau protein detection, revealed normal levels; however, prion proteins were amplified by the real-time quaking-induced conversion method. Hashimoto's encephalopathy was excluded on the basis of unresponsiveness to corticosteroids. The symptoms progressed slowly. Periodic sharp-wave complexes were observed on electroencephalogram 36 months after the onset of symptoms; the patient reached a state of akinetic mutism at 47 months. This was a probable case of MM2-cortical-type sCJD with anti-NAE antibodies based on the World Health Organization (WHO) diagnostic criteria for sCJD, genetic information, and the slowly progressive course. However, this case did not meet with the probable WHO diagnostic criteria until 3 years after symptom onset, highlighting the difficulty of diagnosing a living case of the MM2-type of sCJD. Therefore, establishment of clinical diagnostic criteria for MM2-type of sCJD is required.
TL;DR: The ancestral origin of PFAR is discussed in the light of the ancient RNA world hypothesis, and how this ribosomal activity fits into the landscape of cellular protein chaperones involved in the appearance and propagation of prions and other amyloids in mammals is considered.
Abstract: It is no longer necessary to demonstrate that ribosome is the central machinery of protein synthesis. But it is less known that it is also key player of the protein folding process through another conserved function: the protein folding activity of the ribosome (PFAR). This ribozyme activity, discovered more than 2 decades ago, depends upon the domain V of the large rRNA within the large subunit of the ribosome. Surprisingly, we discovered that anti-prion compounds are also potent PFAR inhibitors, highlighting an unexpected link between PFAR and prion propagation. In this review, we discuss the ancestral origin of PFAR in the light of the ancient RNA world hypothesis. We also consider how this ribosomal activity fits into the landscape of cellular protein chaperones involved in the appearance and propagation of prions and other amyloids in mammals. Finally, we examine how drugs targeting the protein folding activity of the ribosome could be active against mammalian prion and other protein aggregation-based diseases, making PFAR a promising therapeutic target for various human protein misfolding diseases.
TL;DR: Soradic fatal insomnia (sFI) is a rapid progressive neurodegenerative disease characterized by gradual to perpetual insomnia, followed by dysautonomia, coma and death as mentioned in this paper.
Abstract: Background: Sporadic fatal insomnia (sFI) is a rapid progressive neurodegenerative disease characterised by gradual to perpetual insomnia, followed by dysautonomia, coma and death.1 The cause of sF...
TL;DR: This paper developed differentiated neurosphere cultures from the cervid-expressing mice to investigate whether this in vitro system would support replication of nonadapted cervid origin chronic wasting disease (CWD) prions.
Abstract: A possible strategy to develop more diverse cell culture systems permissive to infection with naturally occurring prions is to exploit culture of neurospheres from transgenic mice expressing the normal prion protein (PrP) of the native host species. Accordingly, we developed differentiated neurosphere cultures from the cervid PrP-expressing mice to investigate whether this in vitro system would support replication of non-adapted cervid-origin chronic wasting disease (CWD) prions. Here we report the successful amplification of disease-associated PrP in differentiated neurosphere cultures within 3 weeks after exposure to CWD prions from both white-tailed deer or elk. This neurosphere culture system provides a new in vitro tool that can be used to assess non-adapted CWD prion propagation and transmission.
TL;DR: It is concluded that slow decoding of particular codons induces defects in protein homeostasis that interfere with key steps in cytokinesis and nuclear segregation.
Abstract: Modified nucleosides in tRNA anticodon loops such as 5-methoxy-carbonyl-methyl-2-thiouridine (mcm5s2U) and pseuduridine (Ψ) are thought to be required for an efficient decoding process. In Saccharomyces cerevisiae, the simultaneous presence of mcm5s2U and Ψ38 in tRNAGlnUUG was shown to mediate efficient synthesis of the Q/N rich [PIN+] prion forming protein Rnq1. 1 In the absence of these two tRNA modifications, higher than normal levels of hypomodified tRNAGlnUUG, but not its isoacceptor tRNAGlnCUG can restore Rnq1 synthesis. Moroever, tRNA overexpression rescues pleiotropic phenotypes that associate with loss of mcm5s2U and Ψ38 formation. Notably, combined absence of different tRNA modifications are shown to induce the formation of protein aggregates which likely mediate severe cytological abnormalities, including cytokinesis and nuclear segregation defects. In support of this, overexpression of the aggregating polyQ protein Htt103Q, but not its non-aggregating variant Htt25Q phenocopies these cytological abnormalities, most pronouncedly in deg1 single mutants lacking Ψ38 alone. It is concluded that slow decoding of particular codons induces defects in protein homeostasis that interfere with key steps in cytokinesis and nuclear segregation.
TL;DR: It is shown that inoculation of rec-PrP fibrils does not always cause clinical TSE disease or increased infectious titre, but can seed the formation of PrP amyloid plaques in PrP-P101L knock-in transgenic mice (101LL).
Abstract: Transmissible spongiform encephalopathies (TSEs) are caused by an infectious agent that is thought to consist of only misfolded and aggregated prion protein (PrP). Unlike conventional micro-organisms, the agent spreads and propagates by binding to and converting normal host PrP into the abnormal conformer, increasing the infectious titre. Synthetic prions, composed of refolded fibrillar forms of recombinant PrP (rec-PrP) have been generated to address whether PrP aggregates alone are indeed infectious prions. In several reports, the development of TSE disease has been described following inoculation and passage of rec-PrP fibrils in transgenic mice and hamsters. However in studies described here we show that inoculation of rec-PrP fibrils does not always cause clinical TSE disease or increased infectious titre, but can seed the formation of PrP amyloid plaques in PrP-P101L knock-in transgenic mice (101LL). These data are reminiscent of the "prion-like" spread of misfolded protein in other models of neurodegenerative disease following inoculation of transgenic mice with pre-formed amyloid seeds. Protein misfolding, even when the protein is PrP, does not inevitably lead to the development of an infectious TSE disease. It is possible that most in vivo and in vitro produced misfolded PrP is not infectious and that only a specific subpopulation is associated with infectivity and neurotoxicity.
TL;DR: The development of a serial protein misfolding cyclic amplification method for the detection of H-BSE is shown, which could detect PrPSc from 3 distinct experimental isolates of H -BSE, could detectPrPSc in as little as 1×10−12 g of brain material and was highly specific.
Abstract: The in vitro amplification of prions by serial protein misfolding cyclic amplification has been shown to detect PrPSc to levels at least as sensitive as rodent bioassay but in a fraction of the time. Bovine spongiform encephalopathy is a zoonotic prion disease in cattle and has been shown to occur in 3 distinct forms, classical BSE (C-BSE) and 2 atypical BSE forms (L-BSE and H-BSE). Atypical forms are usually detected in asymptomatic, older cattle and are suggested to be spontaneous forms of the disease. Here, we show the development of a serial protein misfolding cyclic amplification method for the detection of H-BSE. The assay could detect PrPSc from 3 distinct experimental isolates of H-BSE, could detect PrPSc in as little as 1×10-12 g of brain material and was highly specific. Additionally, the product of serial protein misfolding cyclic amplification at all dilutions of seed analyzed could be readily distinguished from L-BSE, which did not amplify, and C-BSE, which had PrPSc with distinct protease K-resistance and protease K-resistant PrPSc molecular weights.
TL;DR: It is demonstrated that the flexible, N-terminal domain of PrPC possesses toxic effector functions, which are regulated by a docking interaction with the structured, C-terminAL domain, which may contribute to the neurotoxicity of PrPSc and possibly other protein aggregates, and could play a role in the physiological activity of Pr PC.
Abstract: The normal function of PrPC, the cellular prion protein, has remained mysterious since its first description over 30 years ago. Amazingly, although complete deletion of the gene encoding PrPC has little phenotypic consequence, expression in transgenic mice of PrP molecules carrying certain internal deletions produces dramatic neurodegenerative phenotypes. In our recent paper, 1 we have demonstrated that the flexible, N-terminal domain of PrPC possesses toxic effector functions, which are regulated by a docking interaction with the structured, C-terminal domain. Disruption of this inter-domain interaction, for example by deletions of the hinge region or by binding of antibodies to the C-terminal domain, results in abnormal ionic currents and degeneration of dendritic spines in cultured neuronal cells. This mechanism may contribute to the neurotoxicity of PrPSc and possibly other protein aggregates, and could play a role in the physiological activity of PrPC. These results also provide a warning about the potential toxic side effects of PrP-directed antibody therapies for prion and Alzheimer's diseases.
TL;DR: Despite the lack of CWD reports in Brazil, the examined codons (95, 96, 116, 132, 225, and 226) of the PRNP gene showed potential CWD susceptibility in Brazilian deer.
Abstract: Prion diseases are neurodegenerative fatal disorders that affect human and non-human mammals. Chronic Wasting Disease (CWD) is a prion disease of cervids regarded as a public health problem in North America, and polymorphisms at specific codons in the PRNP gene are associated with this disease. To assess the potential CWD susceptibility of South American free-ranging deer, the presence of these polymorphisms was examined in Mazama gouazoubira, Ozotoceros bezoarticus and Blastocerus dichotomus. Despite the lack of CWD reports in Brazil, the examined codons (95, 96, 116, 132, 225, and 226) of the PRNP gene showed potential CWD susceptibility in Brazilian deer. Low abundancy of deer in Brazil possibly difficult both CWD proliferation and detection, however, CWD surveillance may not be neglected.
TL;DR: The first case of V180I rare mutation in a Brazilian woman whose clinical condition started with memory impairment for recent events and insomnia with 2 months of evolution is reported, without any other alterations in neurological examination.
Abstract: Here, we report the first case of V180I rare mutation in a Brazilian woman whose clinical condition started with memory impairment for recent events and insomnia with 2 months of evolution, without any other alterations in neurological examination. Both the electroencephalogram (EEG) and the routine biochemical examination of cerebrospinal fluid (CSF) were normal. CSF 14-3-3 protein search was positive. Magnetic resonance imaging (MRI) of the encephalon showed findings suggestive of Creutzfeldt-Jakob disease, confirmed by sequencing of PRNP gene that reveal V180I mutation also homozygosity for methionine at codon 129 (M129M).
TL;DR: In contrast to wild-type mice expressing GPI-anchored PrP, in lymphoid tissues of tg anchorless mice, PrPSc was not associated with follicular dendritic cells (FDC), and FDC did not display typical prion-associated pathogenic changes.
Abstract: In most human and animal prion diseases the abnormal disease-associated prion protein (PrPSc) is deposited as non-amyloid aggregates in CNS, spleen and lymphoid organs. In contrast, in humans and transgenic mice with PrP mutations which cause expression of PrP lacking a glycosylphosphatidylinositol (GPI)-anchor, most PrPSc is in the amyloid form. In transgenic mice expressing only anchorless PrP (tg anchorless), PrPSc is deposited not only in CNS and lymphoid tissues, but also in extraneural tissues including heart, brown fat, white fat, and colon. In the present paper, we report ultrastructural studies of amyloid PrPSc deposition in extraneural tissues of scrapie-infected tg anchorless mice. Amyloid PrPSc fibrils identified by immunogold-labeling were visible at high magnification in interstitial regions and around blood vessels of heart, brown fat, white fat, colon, and lymphoid tissues. PrPSc amyloid was located on and outside the plasma membranes of adipocytes in brown fat and cardiomyocytes, and appeared to invaginate and disrupt the plasma membranes of these cell types, suggesting cellular damage. In contrast, no cellular damage was apparent near PrPSc associated with macrophages in lymphoid tissues and colon, with enteric neuronal ganglion cells in colon or with adipocytes in white fat. PrPSc localized in macrophage phagolysosomes lacked discernable fibrils and might be undergoing degradation. Furthermore, in contrast to wild-type mice expressing GPI-anchored PrP, in lymphoid tissues of tg anchorless mice, PrPSc was not associated with follicular dendritic cells (FDC), and FDC did not display typical prion-associated pathogenic changes.
TL;DR: It is shown that the VPS10P sorting receptor sortilin negatively regulates PrPSc accumulation in prion-infected neurons, by interacting with PrPC and PrP sc and trafficking them to lysosomes for degradation.
Abstract: Conformational conversion of the cellular prion protein, PrPC, into the abnormally folded isoform of prion protein, PrPSc, which leads to marked accumulation of PrPSc in brains, is a key pathogenic event in prion diseases, a group of fatal neurodegenerative disorders caused by prions. However, the exact mechanism of PrPSc accumulation in prion-infected neurons remains unknown. We recently reported a novel cellular mechanism to support PrPSc accumulation in prion-infected neurons, in which PrPSc itself promotes its accumulation by evading the cellular inhibitory mechanism, which is newly identified in our recent study. We showed that the VPS10P sorting receptor sortilin negatively regulates PrPSc accumulation in prion-infected neurons, by interacting with PrPC and PrPSc and trafficking them to lysosomes for degradation. However, PrPSc stimulated lysosomal degradation of sortilin, disrupting the sortilin-mediated degradation of PrPC and PrPSc and eventually evoking further accumulation of PrPSc in prion-infected neurons. These findings suggest a positive feedback amplification mechanism for PrPSc accumulation in prion-infected neurons.
TL;DR: A piece of the prion domain is identified that is neither necessary for the conformational transition of PrPC nor for the formation of a stable prion structure.
Abstract: Mapping out regions of PrP influencing prion conversion remains a challenging issue complicated by the lack of prion structure. The portion of PrP associated with infectivity contains the α-helical domain of the correctly folded protein and turns into a β-sheet-rich insoluble core in prions. Deletions performed so far inside this segment essentially prevented the conversion. Recently we found that deletion of the last C-terminal residues of the helix H2 was fully compatible with prion conversion in the RK13-ovPrP cell culture model, using 3 different infecting strains. This was in agreement with preservation of the overall PrPC structure even after removal of up to one-third of this helix. Prions with internal deletion were infectious for cells and mice expressing the wild-type PrP and they retained prion strain-specific characteristics. We thus identified a piece of the prion domain that is neither necessary for the conformational transition of PrPC nor for the formation of a stable prion structure.