TL;DR: It is shown that the genus Streptomyces is still the largest current producer of new and innovative secondary metabolites, with a significantly high number of novel StrePTomyces spp.
Abstract: There is a real consensus that new antibiotics are urgently needed and are the best chance for combating antibiotic resistance. The phylum Actinobacteria is one of the main producers of new antibiotics, with a recent paradigm shift whereby rare actinomycetes have been increasingly targeted as a source of new secondary metabolites for the discovery of new antibiotics. However, this review shows that the genus Streptomyces is still the largest current producer of new and innovative secondary metabolites. Between January 2015 and December 2020, a significantly high number of novel Streptomyces spp. have been isolated from different environments, including extreme environments, symbionts, terrestrial soils, sediments and also from marine environments, mainly from marine invertebrates and marine sediments. This review highlights 135 new species of Streptomyces during this 6-year period with 108 new species of Streptomyces from the terrestrial environment and 27 new species from marine sources. A brief summary of the different pre-treatment methods used for the successful isolation of some of the new species of Streptomyces is also discussed, as well as the biological activities of the isolated secondary metabolites. A total of 279 new secondary metabolites have been recorded from 121 species of Streptomyces which exhibit diverse biological activity. The greatest number of new secondary metabolites originated from the terrestrial-sourced Streptomyces spp.
TL;DR: The role of LAB inoculants in silage production as well as the modern biotechnology approaches, including metabolomics, proteomics, metagenomics, genomics, transcriptomics, and genetic manipulation, are elucidated, which are powerful tools for identifying, improving, and developing high-performance LAB strains.
Abstract: Ensiling is a microbial-driven process used to preserve fresh forage in bio-refinery and animal production. The biochemical changes that ensue during ensiling have aided the search for new silage additives, emphasizing the potential of certain microbial strains that are more efficient in biopreservation. Lactic acid bacteria (LAB) species are widely recognized for their varied application as additives in the fermentation of crops or forage biomasses during ensiling. However, inconsistency in silage quality in recent times could be interpreted by the lack of information on gene expression and molecular mechanisms of microbiota involved in silage production. Modern research has focused on unraveling nutrient-rich animal feed with improved LAB inoculants. Therefore, this review elucidates the role of LAB inoculants in silage production as well as the modern biotechnology approaches, including metabolomics, proteomics, metagenomics, genomics, transcriptomics, and genetic manipulation, which are powerful tools for identifying, improving, and developing high-performance LAB strains. In addition, the review highlighted the trends and future perspectives of LAB development for silage improvement, pertinent for animal feed breakthroughs in sustainable agriculture.
TL;DR: In conclusion, PGPR alters the physiological and metabolic responses of soybean enabling it to cope better with chromate and arsenic toxicity and grow well under the stress.
Abstract: AIM
of the current research was to use plant growth promoting rhizobacteria for sequestration and biotransformation of the toxic form of Cr and As into non-toxic form. Remediating these contaminants using microbes is a common technique and rhizo-microbiota not only relieves metal stress but also acts as biofertilizers. Role of plant growth-promoting rhizobacterial (PGPR) strains Acinetobacter beijerinckii (C5) and Raoultella planticola (C9) in counteracting chromium and arsenic stress in soybean seedlings was assessed. The isolated rhizobacteria were able to tolerate excessive quantities (up to 1200 ppm) of chromate and arsenate in liquid media. Beside their growth in heavy metal containing media, the strains were able to bio-transform chromate and arsenate to their least toxic form. They released significant quantities of stress related metabolites including phenols, flavonoids, proline, sugars and protein even in the presence of 1200 ppm of the heavy metals. They also released several plant hormones together with indole-3-acetic acid (IAA), salicylic acid (SA) and gibberellins. Another important feature of the isolates was their ability to solubilize phosphate and release siderophores and exposure to different levels of the selected heavy metals enhanced phosphate solubilization potential of both the isolates by up to 2-fold. Release of siderophore in A. beijerinckii C5 was enhanced by increasing heavy metals concentration in the media but in case of R. planticola C9 a decline was noted. When inoculated on soybean seedlings, the isolates modulated several metabolites of the hos plant enabling them to combat heavy metal toxicity at different levels. The PGPR strains boosted host's antioxidants production which minimized the oxidative damage by scavenging excessive ROS produced under stress. Control plants showed upregulation of stress response metabolites compared to PGPR application, whereas, IAA and SA were significantly higher in PGPR associated seedlings. In conclusion, PGPR alters the physiological and metabolic responses of soybean enabling it to cope better with chromate and arsenic toxicity and grow well under the stress.
TL;DR: This review provides a succinct overview of various sources, biosynthetic mechanisms, and genes governing Deoxynivalenol production, along with its consequences on human and animal health.
Abstract: Mycotoxins are fungi-produced secondary metabolites that can contaminate many foods eaten by humans and animals. Deoxynivalenol (DON), which is formed by Fusarium, is one of the most common occurring predominantly in cereal grains and thus poses a significant health risk. When DON is ingested, it can cause both acute and chronic toxicity. Acute signs include abdominal pain, anorexia, diarrhea, increased salivation, vomiting, and malaise. The most common effects of chronic DON exposure include changes in dietary efficacy, weight loss, and anorexia. This review provides a succinct overview of various sources, biosynthetic mechanisms, and genes governing DON production, along with its consequences on human and animal health. It also covers the effect of environmental factors on its production with potential detection, management, and control strategies.
TL;DR: Omicron BA.2.75 is a subvariant believed to be able to suppress the currently dominant BA.5 and cause a new winter wave of the COVID-19 pandemic as discussed by the authors .
Abstract: SARS-CoV-2 belongs to the group of RNA viruses with a pronounced tendency to mutate. Omicron BA.2.75 is a subvariant believed to be able to suppress the currently dominant BA.5 and cause a new winter wave of the COVID-19 pandemic. Omicron BA.2.75 is characterized by a greater infectivity compared to earlier Omicron variants. However, the Gibbs energy of the biosynthesis of virus particles is slightly less negative compared to those of other variants. Thus, the multiplication rate of Omicron BA.2.75 is lower than that of other SARS-CoV-2 variants. This leads to slower accumulation of newly formed virions and less damage to host cells, indicating evolution of SARS-CoV-2 toward decreasing pathogenicity.
TL;DR: In this article , a review of the prevalence and antimicrobial resistance of Salmonella spp. in chicken and poultry products from various countries in Asia is presented, and the methods for detecting salmonella will also be discussed.
Abstract: Multidrug-resistant Salmonella spp. is one of the leading causes of worldwide foodborne disease outbreaks. Animal-derived foods, particularly chicken and poultry products, are the most likely source of Salmonella transmission to humans. The increasing demand for chicken meat has raised a global food safety issue. This review aims to determine the prevalence and antimicrobial resistance of Salmonella spp. in chickens from various countries in Asia. The methods for detecting Salmonella will also be discussed in this review. The prevalence of Salmonella spp. in chicken and poultry products is lower in developed countries than in developing countries. In addition, the incidence of Salmonella spp. in chicken and poultry products from fresh markets is higher than those from supermarkets. Furthermore, this review also reported the presence of multidrug-resistant Salmonella strains in various Asian countries. Rapid Salmonella detection based on immunological assays, molecular-based assays, and biosensors can provide more accurate results with high sensitivity and specificity. These methods also require a shorter time than the cultural-based Salmonella detection method. The use of suitable detection methods to determine the presence of Salmonella spp. in chicken and poultry products is important to ensure food safety.
TL;DR: In the last ten years, Stenotrophomonas maltophilia has gained increasing interest as an important agent of infection, which is why it has come to be recognized as a serious cause of nosocomial infections related to bloodstream infections, pneumonia, and cancer, mainly in patients with intensive care, and is associated with high mortality rates in immunocompromised patients, with prolonged hospital stays and extensive use of antimicrobials as discussed by the authors .
Abstract: In the last ten years, Stenotrophomonas maltophilia has gained increasing interest as an important agent of infection, which is why it has come to be recognized as a serious cause of nosocomial infections related to bloodstream infections, pneumonia, and cancer, mainly in patients with intensive care, and is associated with high mortality rates in immunocompromised patients, with prolonged hospital stays and extensive use of antimicrobials. The importance of this microorganism lies in its low pathogenicity, high multiresistance to various antibiotics, and frequent and persistent isolation in predisposed patients. In addition, few studies have evaluated its epidemiology and clinical relevance. The pathogenesis of biofilms lies mainly in the fact that they can generate persistent chronic infections that are difficult to eradicate. To this extent, it is important to make the characteristics of the biofilm formation behavior of Stenotrophomonas maltophilia known and generate more knowledge about its colonization or infection in humans through this review, which discusses more recent information.
TL;DR: Assessment of the antibacterial effect and mode of action of secondary metabolites from fungal endophyte associated with Aloe ferox Mill finds Aspergillus welwitschiae MK450668.1 serves as a potential source of effective compounds to combat the challenge of drug resistance.
Abstract: The constant increase in drug resistance, occurrence of incurable diseases and high medical costs, have necessitated bio-prospecting of fungi as alternative sources of therapeutic compounds. This study aimed at assessing the antibacterial effect and mode of action of secondary metabolites from fungal endophyte associated with Aloe ferox Mill. Endophytic fungus was isolated from the gel of A. ferox and identified by internal transcribed spacer (ITS) rRNA gene sequence analysis. The targets of antibacterial activity were assessed based on minimum inhibitory concentration (MIC) and the effect of the extract on respiratory chain dehydrogenase (RCD) and membrane integrity. Fourier transform-infrared spectrophotometer (FTIR) was employed to ascertain functional groups. The fungus with the most promising antibiotic-production was identified as Aspergillus welwitschiae MK450668.1. Its extract exhibited antibacterial activity with the MIC values of 0.5 and 1 mg/mL against Staphylococcus aureus (ATCC 25925) and Escherichia coli (ATCC 25922). It demonstrated the inhibitory effect on the RCD activity and destruction of membrane integrity on the test bacteria. FTIR spectrum revealed hydroxyl, amine and alkene groups. A. welwitschiae MK450668.1 serves as a potential source of effective compounds to combat the challenge of drug resistance.
TL;DR: In this paper , the antimicrobial properties of Pistacia lentiscus and Fortunella margarita essential oils (EOs) were evaluated and the results indicated that both EOs constitute effective antimicrobial sources with many potent applications in the food industry.
Abstract: Nowadays, the use of antimicrobial natural agents as alternative food preservatives represents an intriguing case. The purpose of this study was to investigate possible antimicrobial activity of Pistacia lentiscus and Fortunella margarita essential oils (EOs) and to evaluate their commercial potential in the food industry. The main constituents identified by GC/MS in Pistacia lentiscus EO were a-pinene (67.7%), myrcene (18.8%), and β-pinene (3.0%), whereas limonene (93.8%) and myrcene (2.7%) were the dominant compounds in Fortunella margarita EO. The antimicrobial properties were initially assayed and the minimum inhibitory, non-inhibitory, and minimum lethal concentration values against the Escherichiacoli, Listeria monocytogenes, Pseudomonas fragi, Aspergillus niger, and Saccharomyces cerevisiae were determined using a previously published model, combining absorbance measurements with the common dilution method and non-linear regression analysis to fit the data. Their efficiency was further validated in ice cream containing 0.2% (w/w) Pistacia lentiscus, 0.006% (w/w) Fortunella margarita EOs and 2% (w/w) aqueous residue of F. margarita EO deliberately inoculated with 4 logcfu/g Escherichiacoli, Listeria monocytogenes or Pseudomonas fragi, separately. Similarly, the activity of the oils was monitored in fruit juice (lemon, apple, and blackcurrant) containing 0.2% (w/w) Pistacia lentiscus, 0.006% (w/w) Fortunella margarita EOs and 2% (w/w) aqueous residue of F. margarita EO deliberately spiked with 100 spores/mL of Aspergillus niger or 4 logcfu/mL of Saccharomyces cerevisiae, separately. The results showed that microbial viable counts in the supplemented products ranged at significantly lower levels compared to the control samples during storage. Overall, the data indicated that both EOs constitute effective antimicrobial sources with many potent applications in the food industry.
TL;DR: Carbapenem-resistant Enterobacteriaceae are common among other parts of India, despite limited access to antibiotics, the emergence of resistance in the northeastern region is worrying.
Abstract: (Background) Numerous reports on carbapenem resistance in different parts of India have been published, yet there are insufficient studies on the prevalence of antibiotic resistance in the northeast region of the country. This study evaluated the emergence of carbapenem resistance in the clinical isolates collected in Mizoram. (Results) A total of 141 Gram-negative clinical isolates were collected from the two hospitals, including the Civil Hospital in Lunglei and the Synod Hospital in Aizawl. The isolates include Escherichia coli (n = 62, 43.9%), Klebsiella spp. (n = 43, 30.4%), Pseudomonas aeruginosa (n = 9, 6.3%), Serratia marcescens (n = 3, 2.1%), Proteus mirabilis (n = 2, 1.4%), Shigella spp. (n = 4, 2.8%), Enterobacter spp. (n = 6, 4.2%) and Acinetobacter spp. (n = 12, 8.5%). The isolates were found to be resistant to meropenem (11%), colistin (48%), tigecycline (25%) and cefotaxime (50%). A total of four E. coli and one Shigella sonnei encoded the blaOXA-48-like gene. The blaCTX-M-1 gene was detected in 13 isolates, of which eight were E. coli, two Shigella flexneri, and one isolates each of K. pneumoniae, K. oxytoca and Shigella sonnei, respectively. (Conclusion) Carbapenem-resistant Enterobacteriaceae are common among other parts of India, despite limited access to antibiotics, the emergence of resistance in the northeastern region is worrying.
TL;DR: In this article , 12 native bacteria previously isolated in soils of cocoa farms located in the western Colombian Andes (Santander), and tolerant to 2500 µM CdCl2 (120 mg Cd/L), were chosen in order to test their tolerance and Cd immobilization using liquid culture medium (Nutritive broth) at different concentrations of heavy metals.
Abstract: Twelve cadmium native bacteria previously isolated in soils of cocoa farms located in the western Colombian Andes (Santander), and tolerant to 2500 µM CdCl2 (120 mg Cd/L), were chosen in order to test their tolerance and Cd immobilization using liquid culture medium (Nutritive broth) at different concentrations of heavy metals. Furthermore, in the greenhouse experiments, the strains Exiguobacterium sp. (11-4A), Klebsiella variicola sp. (18-4B), and Enterobacter sp. (29-4B) were applied in combined treatments using CCN51 cacao genotype seeds grown in soil with different concentrations of Cd. All bacterial strains’ cell morphologies were deformed in TEM pictures, which also identified six strain interactions with biosorption and four strain capacities for bioaccumulation; FT-IR suggested that the amide, carbonyl, hydroxyl, ethyl, and phosphate groups on the bacteria biomass were the main Cd binding sites. In the pot experiments, the concentration of Cd was distributed throughout the cacao plant, but certain degrees of immobilization of Cd can occur in soil to prevent an increase in this level in roots with the presence of Klebsiella sp.
TL;DR: In this paper , the effect of alkaline sulfide leaching (ASL) on the extraction of copper and zinc from low-grade copper concentrate containing chalcopyrite, tennantite, sphalerite, and pyrite during batch and continuous bioleaching experiments was studied.
Abstract: In the present work the effect of alkaline sulfide leaching (ASL) on the extraction of copper and zinc from low-grade copper concentrate containing chalcopyrite, tennantite, sphalerite, and pyrite during batch and continuous bioleaching experiments was studied. It was demonstrated that ASL and further bioleaching may be a promising approach for treatment of copper–zinc concentrates containing tennantite as this approach allows increasing copper extraction degree in comparison to one-stage bioleaching by 1.6–2.3 times. Thus, ASL was shown to be effective for pretreatment of tennantite containing concentrates to improve bioleaching for copper extraction. At the same time, ASL led to decrease in zinc extraction by 1.4–1.5 times. Therefore, the development of combined hydrometallurgical processes including ASL and bioleaching for effective metal leaching requires further studies to avoid negative effect on zinc extraction.
Abstract: Mononchida members are predatory nematodes with the potential to reduce the number of plant-parasitic nematodes in the soil. During a survey on Mononchida in Iran, several populations of Mylonchulus were recovered from various localities. A population of M. hawaiiensis was studied using 18S rDNA. The phylogenetic analysis using Bayesian inference placed the sequenced M. hawiinesis (OP210758) together with other M. hawaiiensis from Japan (AB361438-AB361442) with a 1.00 posterior probability support. In addition, morphological differences between six Mylonchulus (Nematoda; order: Mononchida; Family: Mylonchulidae) populations were investigated in Iran using discriminant analyses (DA), PERMANOVA, and principal coordinate analysis (PCoA). The purpose was to evaluate the efficacy of PCoA and DA in separating the Mylonchulus species, namely M. sigmaturus, M. paitensis, M. lacustris, M. brachyuris, M. kermaninesis, and M. hawaiiensis. To achieve this, 16 morphometric measurements (body length, a, b, c, c′, V, G1, G2, buccal cavity length, buccal cavity width, dorsal tooth apex, dorsal tooth length, neck length, amphid from anterior end, rectum, and tail length) were made on 160 specimens. The analysis of variance showed that all features were significantly different among the species, except a, b, and the amphid position from the anterior end and tail length. The stepwise discriminant analysis revealed that body length, tail length, neck length, and c′ value were the four most discriminating variables useful to distinguish clearly the six species of Mylonchulus. The variables with strong discriminatory power correctly classified 98.87% of individuals from Iran’s sample of known Mylonchulus species. The results provide a morphometric basis for effectively distinguishing Mylonchulus species.
TL;DR: DNA concentrations were determined to be the best universal monitoring method for complex environmental samples and provide the advantages of rapid extraction, consistency between replicates and the potential for downstream analysis.
Abstract: This paper focuses on the comparison of microbial biomass increase (cell culture growth) using field-relevant testing methods and moving away from colony counts. Challenges exist in exploring the antimicrobial growth of fastidious strains, poorly culturable bacteria and bacterial communities of environmental interest. Thus, various approaches have been explored to follow bacterial growth that can be efficient surrogates for classical optical density or colony-forming unit measurements. Here, six species grown in pure culture were monitored using optical density, ATP assays, DNA concentrations and 16S rRNA qPCR. Each of these methods have different advantages and disadvantages concerning the measurement of growth and activity in complex field samples. The species used as model systems for monitoring were: Acetobacterium woodii, Bacillus subtilis, Desulfovibrio vulgaris, Geoalkalibacter subterraneus, Pseudomonas putida and Thauera aromatica. All four techniques were found to successfully measure and detect cell biomass/activity differences, though the shape and accuracy of each technique varied between species. DNA concentrations were found to correlate the best with the other three assays (ATP, DNA concentrations and 16S rRNA-targeted qPCR) and provide the advantages of rapid extraction, consistency between replicates and the potential for downstream analysis. DNA concentrations were determined to be the best universal monitoring method for complex environmental samples.
TL;DR: Established and novel treatment options for oropharyngeal fungal infections in HIV/AIDS patients, including Amphotericin B and immunoglobulin antibodies, revealed promising antifungal effects for immunocompromised individuals.
Abstract: HIV and AIDS patients are susceptible to opportunistic infections. Oral candidiasis or thrush is the primary manifestation of fungal infection in these patients. The primary objective of this literature review was to summarize established and novel treatment options for oropharyngeal fungal infections in HIV/AIDS patients. Azoles and polyenes are the two primary antifungal drug classes employed for the treatment of oral candidiasis. A literature review was conducted on Medline and Google Scholar in October of 2021 using the keywords “Oral”, “Fungal”, “HIV”, and “Treatment”. Included studies were clinical trials, meta-analyses, and randomized controlled trials. Twenty-one studies regarding azoles, polyenes, and novel treatments for oropharyngeal fungal infections in HIV/AIDS patients were examined in this review. The primary concern demonstrated from these studies is increased reports of resistance to antifungals, especially development of fluconazole resistance. Additionally, studies demonstrated that fluconazole had different relapse durations comparative to other medications, and that posaconazole could possibly act as an alternate form of treatment. Nystatin was indicated as a first-line therapy for thrush in multiple studies but could be upstaged by miconazole nitrate in resource-poor settings. Amphotericin B was an effective treatment option and was shown to be resilient in terms of fungal resistance, however potent adverse side effects were reported. Alternative treatments, such as immunoglobulin antibodies and lemon grass, revealed promising antifungal effects for immunocompromised individuals. Taken together, this review provides a thorough summary of treatment options of oropharyngeal fungal infections in HIV/AIDS patients.
TL;DR: Lactobacillus crispatus M247 is a strain with good intestinal and vaginal adhesion capability, combined with local antibacterial and anti-inflammatory properties; this strain also has proven nontransferable resistance to antibiotics commonly used in female genital tract infections, such as metronidazole as discussed by the authors .
Abstract: The altered patterns of a microbial population colonizing an organ are increasingly recognized as a relevant item in human disease pathogenesis. The female urogenital tract is no exception, as some vaginal microbiota patterns, named community state types (CSTs), and urinary tract microbiota patterns, named urotypes (UTs), have been linked to viral, inflammatory, and gestational diseases. Treating these conditions is an issue, as antibiotic therapies alone are not always effective. Lactobacillus crispatus M247 is a strain with good intestinal and vaginal adhesion capability, combined with local antibacterial and anti-inflammatory properties; this strain also has proven nontransferable resistance to antibiotics commonly used in female genital tract infections, such as metronidazole. Lactobacillus crispatus M247 could, therefore, be considered as a potential add-on therapy to antibiotics in vaginal tract infections, with the aim to restore a favorable microbiota pattern.
TL;DR: An upward trend in the prevalence of DR-TB from 2010 to 2016 is found and Clinicians should weigh in on these patterns while deciding on the best first-line drug combinations to optimize treatment outcomes forDR-TB patients.
Abstract: Background: An understanding of the patterns of drug-resistant tuberculosis (DR-TB) is needed to develop the best diagnostic tools and decide on optimal treatment combination therapies for the management of DR-TB in Nigeria. Objective: We aimed to investigate patterns of DR-TB for the five first-line anti-TB drugs over a period of seven years (2010–2016) and the associated clinical and socio-demographic factors. Methods: A retrospective study recruited 2555 DR-TB patients between 2010 and 2016 across the six geopolitical treatment zones in Nigeria. We determined DR-TB patterns based on standard case definition and their association with demographic and clinical information. Data were analyzed using Statistical Package for Social Sciences (SPSS) software. Independent predictors of DR-TB patterns/types were determined using bivariate and multivariate analyses with a statistical significance of p < 0.05 and a 95% confidence interval. Results: The majority of the participants were males, 66.93% (1710), 31–40 years old, 35.19% (899), previously treated, 77.10% (1909), had received at least two treatments, 411 (49.94%) and were multi-drug resistant, 61.41% (1165). The Southwest zone had the highest number of DR-TB cases, 36.92%. We found an upward trend in the prevalence of DR-TB from 2010 to 2016. Participants who had received one previous treatment showed statistically significant higher rifampicin resistance (59.68%), those with two previous treatments reported a statistically significant higher polydrug resistance (78.57%), and those with three or more previous treatments had a statistically significant higher multidrug resistance (19.83%) (χ2 = 36.39; p = 0.001). Mono-drug resistance and rifampicin resistance were statistically significantly higher in the southwest zone (29.48% and 34.12% respectively), polydrug resistance in the northcentral (20.69%) and south-south zones (20.69%), and multidrug resistance in the southwest (30.03%) and northcentral zones (19.18%) (χ2 = 98.26; p = 0.001). Conclusions: We present patterns of DR-TB across the six geopolitical zones in Nigeria. Clinicians should weigh in on these patterns while deciding on the best first-line drug combinations to optimize treatment outcomes for DR-TB patients. A national scale-up plan for DST services should focus on patients with previous multiple exposures to anti-TB treatments and on those in the Northeastern zone of the country.
TL;DR: The study demonstrates the wide spectrum potent in vitro biocidal efficacy of the cuprous oxide impregnated dressings against a wide panel of microorganisms.
Abstract: Copper has intrinsic antimicrobial properties. Wound dressings impregnated with cuprous oxide microparticles (hereafter termed COD) have been cleared for the management of acute and chronic wounds by the FDA and other regulatory bodies. The COD reduced the viable microbial titers of a wide spectrum of microbes by more than 10,000-fold (4-logs) within 3 h of exposure at 37 °C (p < 0.001). Similar microbial titer reductions were achieved by 3-year naturally aged COD dressings, showing the stability of the biocidal efficacy over time. The potent biocidal efficacy of the COD was maintained even after 7 daily consecutive inoculations of the dressings with ~106 CFU. COD with an adhesive contour blocked the passage of bacteria from the exterior environment to the wound bed side of the dressing even after 7 daily consecutive inoculations of different bacteria on the outer surface of the dressings. Taken together, the study demonstrates the wide spectrum potent in vitro biocidal efficacy of the cuprous oxide impregnated dressings against a wide panel of microorganisms.
TL;DR: In this paper , three cultures of kombucha were obtained from diverse sources, and different inoculation methods were compared, and the wet and dry weights of the nascent pellicles were measured when cultured on several carbon sources.
Abstract: Kombucha, a domesticated consortium of several microorganisms grown on sugared tea, has been valued as a nutritive health aid for over a millennium. In this study, three cultures of kombucha were obtained from diverse sources. Different inoculation methods were compared, and the wet and dry weights of the nascent pellicles were measured when cultured on several carbon sources. In addition, the anti-bacterial properties of the fermented kombucha teas were tested against Escherichia coli and Staphylococcus epidermis. Inoculation with macerated pellicles gave the fastest kombucha growth. The best carbon sources for growth of the nascent kombucha pellicles were sucrose, glucose, and fructose. On maltose, galactose, and lactose, not only did the kombucha pellicles grow poorly but 25% were also contaminated by common airborne molds. Good growth of the kombucha cultures was correlated with low pH of the fermented tea. Antibacterial effects of concentrated fermented teas and vinegar were similar to those of 1 mmol ampicillin against Escherichia coli or 0.01 mmol penicillin against Staphylococcus epidermis. When the pH of concentrated kombucha teas was neutralized, their bactericidal effects were no better than unfermented controls.
TL;DR: In this article , the authors evaluated the effectiveness of A. oryzae in inhibiting aflatoxin B1 (AFB1) and ochratoxin A (OTA) production by A. flavus and A. carbonarius, respectively, under shifting temperatures.
Abstract: This study aimed to evaluate the effectiveness of A. oryzae in inhibiting aflatoxin B1 (AFB1) and ochratoxin A (OTA) production by A. flavus and A. carbonarius, respectively, under shifting temperatures. A. oryzae was tested on different agar, namely coconut cream agar (CCA) and chili-based agar to figure out the variation in the effectiveness of A. oryzae on the most appropriate medium for A. flavus and A. carbonarius to produce mycotoxin and under natural condition where they are predominantly found. On CCA, the temperatures applied were 20, 30, 35, 40, 20/30, 20/35, and 20/40 °C, while on chili-based agar, the temperatures imposed were 20, 40, and 20/40 °C, at varied water activity of 0.92 and 0.97aw. The findings indicated that A. oryzae was much more effective in inhibiting the growth of A. flavus rather than A. carbonarius, yet it was able to inhibit higher OTA concentration than AFB1 at fluctuating temperatures on CCA as the most appropriate medium for A. flavus and A. carbonarius. A. oryzae effectively inhibited AFB1 and OTA at static temperature of 20 °C and water activity of 0.97aw on chili-based agar. Under fluctuating temperatures (20/40 °C), A. oryzae was also able to control mycotoxin, particularly OTA at high water activity (0.97aw).
TL;DR: In-depth characterization of the molecular and microbiological mechanisms linking the gut–liver axis to portal hypertension in a bidirectional relationship could pave the way to the identification of new therapeutic targets for innovative therapies in the management of ACLD.
Abstract: Clinically significant portal hypertension is associated with most complications of advanced chronic liver disease (ACLD), including variceal bleeding, ascites, spontaneous bacterial peritonitis, hepatorenal syndrome, and hepatic encephalopathy. Gut dysbiosis is a hallmark of ACLD with portal hypertension and consists of the overgrowth of potentially pathogenic bacteria and a decrease in autochthonous bacteria; additionally, congestion makes the intestinal barrier more permeable to bacteria and their products, which contributes to the development of complications through inflammatory mechanisms. This review summarizes current knowledge on the role of the gut–liver axis in the pathogenesis of portal hypertension, with a focus on therapies targeting portal hypertension and the gut microbiota. The modulation of the gut microbiota on several levels represents a major challenge in the upcoming years; in-depth characterization of the molecular and microbiological mechanisms linking the gut–liver axis to portal hypertension in a bidirectional relationship could pave the way to the identification of new therapeutic targets for innovative therapies in the management of ACLD.
TL;DR: The results demonstrate the involvement of both host smallRNAs and vsmRNAs in SARS-CoV-2 infection and identify these small RNAs as potential targets for anti-COVID-19 therapeutic development.
Abstract: After two years into the pandemic of the coronavirus disease 2019 (COVID-19), it remains unclear how the host RNA interference (RNAi) pathway and host miRNAs regulate severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection and impact the development of COVID-19. In this study, we profiled small RNAs in SARS-CoV-2-infected human ACE2-expressing HEK293T cells and observed dysregulated host small RNA groups, including specific host miRNAs that are altered in response to SARS-CoV-2 infection. By comparing dysregulated miRNAs in different SARS-CoV-2-infected samples, we identified miRNA-210-3p, miRNA-30-5p, and miR-146a/b as key host miRNAs that may be involved in SARS-CoV-2 infection. Furthermore, by comparing virally derived small RNAs (vsmRNAs) in different SARS-CoV-2-infected samples, we observed multiple hot spots in the viral genome that are prone to generating vsmRNAs, and their biogenesis can be dependent on the antiviral isoform of Dicer. Moreover, we investigated the biogenesis of a recently identified SARS-CoV-2 viral miRNA encoded by ORF7a and found that it is differentially expressed in different infected cell lines or in the same cell line with different viral doses. Our results demonstrate the involvement of both host small RNAs and vsmRNAs in SARS-CoV-2 infection and identify these small RNAs as potential targets for anti-COVID-19 therapeutic development.
TL;DR: Assessment of synergistic activities between selected conventional antibiotics with these bacteriocins showed that higher concentrations are needed to completely eradicate metabolic activities of cells within pre-formed biofilms in contrast with the biofilm formation abilities of the strains.
Abstract: In this study, we have evaluated the effects of previously characterized bacteriocins produced by E. faecium strains ST651ea, ST7119ea, and ST7319ea, against biofilm formation and biofilms formed by L. monocytogenes ATCC15313 and vancomycin-resistant E. faecium VRE19. The effects of bacteriocins on the biofilms formed by L. monocytogenes ATCC151313 were evaluated by crystal violet assay and further confirmed by quantifying viable cells and cell metabolic activities through flow cytometry and TTC assay, respectively, indicating that bacteriocin activities required to completely eradicate biofilms are at least 1600 AU mL−1, 3200 AU mL−1, and 6400 AU mL−1, respectively for each bacteriocin evaluated. Furthermore, bacteriocins ST651ea and ST7119ea require at least 6400 AU mL−1 to completely eradicate the viability of cells within the biofilms formed by E. faecium VRE19, while bacteriocin ST7319ea requires at least 12800 AU mL−1 to obtain the same observations. Assessment of synergistic activities between selected conventional antibiotics (ciprofloxacin and vancomycin) with these bacteriocins was carried out to evaluate their effects on biofilm formation and pre-formed biofilms of both test microorganisms. Results showed that higher concentrations are needed to completely eradicate metabolic activities of cells within pre-formed biofilms in contrast with the biofilm formation abilities of the strains. Furthermore, synergistic activities of bacteriocins with both ciprofloxacin and vancomycin are more evident against vancomycin-resistant E. faecium VRE19 rather than L. monocytogenes ATCC15313. These observations can be further explored for possible applications of these combinations of antibiotics as a possible treatment of clinically relevant pathogens.
TL;DR: In this article , the authors studied the pathogenic potential of EAEC isolated from various clinical and non-clinical sources in an animal model and found that even from non-diarrheal stools and nonclinical sources, EAEC strainshad the potential to cause prolonged colonization, weight loss, and inflammation in the intestine, though the degree varied.
Abstract: Enteroaggregative Escherichia coli (EAEC) is highly heterogeneous in virulence; we wanted to understand the pathogenic potential of EAEC isolated from various clinical and non-clinical sources in an animal model. We infected male BALB/c mice in six mice/groups with 50 EAEC isolates isolated from clinical and non-clinical sources. We studied colonization, weight loss, stool shedding, and inflammatory markers and their relationship with 21 virulence genes and phylogroups, EAEC organ burden, and histopathological changes. We detected significantly more inflammatory changes and fecal lactoferrin and calprotectin levels in mice infected with EAEC isolated from symptomatic cases. In clinical EAEC isolates, the presence of chromosomal genes (aap (46%), aaiC (23.3%), SPATEs (pet (13.3%), sat (20%), sigA, and pic (6.6%)), the adhesive variantsof EAEC (agg4A (53.3%), aggA (53.3%), aafA (36.6%), andagg3A (40%)), and the master regulator gene aggR (66.6%) were associated with higher levels of lactoferrin and calprotectin. Additionally, 70% (9/13) of EAEC isolated from acute diarrheal cases bearing chuA (70%) in our study were assigned to groups B2 (4 isolates) and D (5 isolates). Real-time PCR analysis revealed that colonization by EAEC strains from different clinical and non-clinical sources occurs up to 10–15 days of life. Even from non-diarrheal stools and non-clinical sources, EAEC strainshad the potential to cause prolonged colonization, weight loss, and inflammation in the intestine, though the degree varied. Moreover, a better understanding of EAEC pathogenic pathways is desperately needed in different clinical scenarios.
TL;DR: In this article , the authors determined the prevalence, incidence, severity and spatial distribution of fungal diseases on sorghum across agro-ecological zones of lower eastern Kenya, where a total of 384 smallholder farmers' fields were surveyed, and in each field, 30 plants were assessed for prevalence and incidence, using a W-shaped pattern to cover the whole field.
Abstract: Sorghum is a staple food crop and plays a critical role in subsistence farming in Kenya due to its adaptability to marginal agro-ecological zones. However, fungal diseases are among the major biotic constraints of sorghum production, causing over 70% yield loss in susceptible cultivars. Information on the distribution and severity of fungal diseases is important to establish efficient and improved strategies for integrated disease management of sorghum fungal diseases. The aim of this study was to determine the prevalence, incidence, severity and spatial distribution of fungal diseases on sorghum across agro-ecological zones of lower eastern Kenya. A total of 384 smallholder farmers’ fields were surveyed, and in each field, 30 plants were assessed for prevalence and incidence of fungal diseases using a W-shaped pattern to cover the whole field. Sorghum anthracnose was the most prevalent disease (71%), followed by leaf blight (70.18%), rust (68.41%), smut (63.02%), sorghum mildew (55.33%), Alternaria leaf spot (48.39%) and rough leaf spot (46.02%). Disease prevalence, incidence and severity varied among the investigated agro-ecological zones. There was a significant difference (p ≤ 0.05) in fungal disease severity across the investigated agro-ecological zones. Spatially interpolated disease maps showed a high variation in the distribution of various sorghum fungal diseases across the investigated agro-ecological zones of lower eastern Kenya. Morpho-cultural identification revealed the association of Colletotrichum sublineola with anthracnose, Curvularia lunata and Bipolaris cynodontis with leaf blight, Puccinia purpurea with rust, Peronosclerospora sorghi with downy mildew, Alternaria alternata with Alternaria leaf spot, Ascochyta sorghi with rough leaf spot and Sporisorium sorghi with covered kernel smut symptoms. Information obtained in this study will be useful to update knowledge on sorghum fungal diseases and provide a basis for the development of strategies for management and control of the investigated diseases.
TL;DR: This work identified the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach and found the genus Aspergillus stood out with three xerophilic species found.
Abstract: Flaxseed (Linum usitatissimum L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of this work was to identify the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach. Fungal identification was performed via high-performance sequencing of the ITS1 region using ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) as primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., San Diego, CA, USA). Six genera and eight species of fungi were found in the sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus, and A. amstelodami, the first being the most abundant. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins. Metataxonomics has proved to be a complete, fast, and efficient method to identify different fungi. Furthermore, high-performance genetic sequencing is an important ally in research, helping to develop novel technological advances related to food safety.
TL;DR: The results revealed the multifaceted functions of peroxisomes in the phytopathogenic fungus and demonstrated the involvement of AaPex3 in maintaining cell wall integrity.
Abstract: Peroxisomes are microbodies involved in the metabolism of fatty acids and hydrogen peroxide (H2O2) in eukaryotes. In the current study, an AaPex3 gene encoding a peroxisome membrane protein was demonstrated to be required for peroxisome biogenesis and resistance to peroxides and superoxide-generating compounds. Deleting AaPex3 affected the expression of the genes encoding the NADPH oxidase (NoxA) and the Yap1 stress-responsive transcription regulator, both of which have been implicated in ROS resistance. The AaPex3-mediated peroxisome biogenesis negatively affected resistance to singlet oxygen-generating compounds, 2-chloro-5-hydroxypyridine (CHP), and 2,3,5-triiodobenzoic acid (TIBA), novel phenotypes associated with peroxisomes. Nile red staining revealed that ΔAaPex3 accumulated more lipid bodies than the wild type. ΔAaPex3 conidia had thinner cell walls than the wild type, suggesting the involvement of AaPex3 in maintaining cell wall integrity. Genetic evidence has also demonstrated that the AaPex3-mediated peroxisome biogenesis is required for conidiogenesis, conidia germination, siderophore biosynthesis, toxin production, and virulence. Biotin or lipids could restore ΔAaPex3 growth in axenic culture and on the surface of citrus leaves. In contrast, co-application of ΔAaPex3 with biotin and oleic acid on citrus leaves failed to induce necrotic lesions. Our results revealed the multifaceted functions of peroxisomes in the phytopathogenic fungus.
TL;DR: This study identifies SpdS as an excellent drug targeting candidate against the malaria parasite, which is localized to the parasite mitochondrion and live fluorescence imaging in blood-stages and sporozoites confirmed a specific mitochondrial localization, not known for any polyamine-synthesizing enzyme so far.
TL;DR: Both growth kinetic parameters and MICs tested effectively measured the inhibitory effects of the test materials; however, growth kinetics provides a more detailed picture of the concentration-dependent effects and those on the mechanisms of microbial growth inhibition.
Abstract: This study compared the minimal inhibition concentrations (MICs) and their effects on the growth kinetics of seven different types of zinc (Zn) compounds and Na2EDTA in the case of three typical commensal beneficial microorganisms (Bacillus subtilis, Lactococcus lactis, and Saccharomyces cerevisiae). The seven Zn compounds included ZnSO4, four Zn–amino acid chelates, and two Zn–EDTA complexes. Both MICs and growth kinetic parameters indicated that different microorganisms show different sensitivities; for example, B. subtilis, L. lactis, and S. cerevisiae were most sensitive to ZnSO4, Na2EDTA, and Zn(NH3)2(Gly)2, respectively. Both ZnEDTA and Zn(NH3)2(Lys)2 improved the growth rate of all beneficial commensal intestinal microorganisms at low concentrations (5–10 mg/L) and showed low toxicity towards all tested strains. At higher concentrations (100–500 mg/L), all compounds decreased the growth rate and increased the lag phase. In conclusion, both growth kinetic parameters and MICs tested effectively measured the inhibitory effects of the test materials; however, growth kinetics provides a more detailed picture of the concentration-dependent effects and those on the mechanisms of microbial growth inhibition.
TL;DR: In this paper , a review of the application of Bacillus metabolites in the control of C. albicans in recent years is presented, including high-precision separation technology and omics technology for the separation of similar components.
Abstract: Candida albicans seriously threatens human health, especially for immunosuppressed groups. The antifungal agents mainly include azoles, polyenes and echinocandins. However, the few types of existing antifungal drugs and their resistance make it necessary to develop new antifungal drugs. Bacillus and its metabolites has antifungal activity against pathogenic fungi. This review introduces the application of Bacillus metabolites in the control of C. albicans in recent years. Firstly, several compounds produced by Bacillus spp. are listed. Then the isolation and identification techniques of Bacillus metabolites in recent years are described, including high-precision separation technology and omics technology for the separation of similar components of Bacillus metabolites. The mechanisms of Bacillus metabolites against C. albicans are distinguished from the inhibition of pathogenic fungi and inhibition of the fungal virulence factors. The purpose of this review is to systematically summarize the recent studies on the inhibition of pathogenic fungi by Bacillus metabolites. The review is expected to become the reference for the control of pathogenic fungi such as C. albicans and the application of Bacillus metabolites in the future.